ID: 978516724

View in Genome Browser
Species Human (GRCh38)
Location 4:109576759-109576781
Sequence AACCTTGGACTACTATTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978516721_978516724 -4 Left 978516721 4:109576740-109576762 CCACTAGGGATGGTGTACTAACC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG 0: 1
1: 0
2: 0
3: 7
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978516724 Original CRISPR AACCTTGGACTACTATTGAT GGG Intronic