ID: 978516724

View in Genome Browser
Species Human (GRCh38)
Location 4:109576759-109576781
Sequence AACCTTGGACTACTATTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978516721_978516724 -4 Left 978516721 4:109576740-109576762 CCACTAGGGATGGTGTACTAACC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG 0: 1
1: 0
2: 0
3: 7
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978516724 Original CRISPR AACCTTGGACTACTATTGAT GGG Intronic
906379100 1:45320384-45320406 AACCTTTCACTGCTATTCATGGG - Intergenic
906569659 1:46825958-46825980 ATCCTTCGCCTACTTTTGATGGG + Intergenic
907133067 1:52114210-52114232 AATCTTGGACTTCAATTGTTGGG + Intergenic
908608784 1:65832111-65832133 ATCTTTGGACTCCTAATGATAGG + Intronic
909730125 1:78879363-78879385 AACCTTTCACTGCTATTTATGGG - Intergenic
917361130 1:174177301-174177323 ATCCTTCGCCTACTTTTGATGGG + Intronic
919869738 1:201811323-201811345 TACCATGGACTACTACTAATGGG - Intronic
922369151 1:224892122-224892144 AACCTTTCACTACTATTCATGGG - Intergenic
923910976 1:238443310-238443332 AACAGTTGACTACTTTTGATTGG + Intergenic
924844014 1:247747186-247747208 TTCCTTGGACTACTATGGAAAGG - Intergenic
1067032476 10:42887562-42887584 AACCCTTGTCTACTTTTGATGGG - Intergenic
1077995662 11:7450030-7450052 AACATTGGATTATTATTCATCGG - Intronic
1078490782 11:11766344-11766366 AACCCTTGTGTACTATTGATGGG + Intergenic
1079768819 11:24432136-24432158 AACCTTGGACTACTTAGGGTAGG + Intergenic
1081120684 11:39261903-39261925 AACCCTGGTATACTGTTGATGGG + Intergenic
1088238611 11:107750795-107750817 AACTACGGAGTACTATTGATAGG - Intergenic
1091819161 12:3461667-3461689 AAGCTTGGACTCCTCTTGAGAGG - Intronic
1092834824 12:12477517-12477539 AACCTTCCACTACTCTGGATGGG - Exonic
1094257850 12:28455401-28455423 ACCCCTGGGCTACTAGTGATAGG + Intronic
1096905521 12:54932008-54932030 AACCTTTCACTGCTATTCATGGG + Intergenic
1098508747 12:71285876-71285898 AACCTTTGAATACTGTTGATGGG - Intronic
1101382153 12:104223531-104223553 AACACTGGACTACCATTGTTGGG + Intronic
1101527158 12:105541678-105541700 AACCCTTGTATACTATTGATAGG - Intergenic
1102073188 12:110038689-110038711 AACCTTGTATTGCTACTGATGGG - Exonic
1102605046 12:114061850-114061872 AACCTTTCACTGCTATTCATGGG - Intergenic
1105032663 12:132894981-132895003 AACCTTTCACTATTATTTATGGG - Intronic
1106603935 13:31210071-31210093 AACCTGGGACTAAGATTTATAGG - Intronic
1108970915 13:56375269-56375291 ACCCTGGGAGTAATATTGATAGG + Intergenic
1109941420 13:69371332-69371354 AACCTGGGACTACTAATGGAGGG + Intergenic
1111412360 13:87893903-87893925 ATCCATGGACTACAATAGATGGG - Intergenic
1111861918 13:93718426-93718448 ATCCTTCGCCTACTTTTGATGGG + Intronic
1113095834 13:106663005-106663027 AACCCAGGACTGCTATTGACGGG - Intergenic
1114345106 14:21786575-21786597 ATCCTTGGATTACAATTGTTGGG + Intergenic
1114770730 14:25427030-25427052 AACCTTTCACTGCTATTCATGGG + Intergenic
1115259967 14:31441701-31441723 AACCTTGTACTAATGTAGATAGG - Intronic
1120304757 14:82755058-82755080 AACATTGGTATACTGTTGATGGG + Intergenic
1121800646 14:96771267-96771289 AACCTTTGCCTACCATTGGTAGG + Intergenic
1132356984 15:101179111-101179133 CACATTGGACTGCTGTTGATCGG - Intronic
1140998240 16:80282106-80282128 AACCTTTAACTACTATTTGTGGG - Intergenic
1149536144 17:57435142-57435164 AACTTGGGGCTACTTTTGATGGG + Intronic
1153427551 18:4982732-4982754 AGCCTTGCACTATTATTGTTGGG - Intergenic
1156588680 18:38461373-38461395 AACATTGGCCTCTTATTGATTGG - Intergenic
1158627052 18:59080554-59080576 ATACTTGGAGTACTATTTATAGG + Intergenic
1160666096 19:329380-329402 CACCTTGGGCTACTATGGAGAGG - Intronic
1162664404 19:12197372-12197394 AACCTTTGTATACTGTTGATGGG - Intergenic
1162686753 19:12393095-12393117 CATCTTAGCCTACTATTGATGGG - Intronic
1162691105 19:12432869-12432891 CATCTTAGCCTACTATTGATGGG - Intronic
929229933 2:39548999-39549021 AACCCTTGTGTACTATTGATGGG - Intergenic
929678653 2:43965893-43965915 AACCCTGGTCTACTGTTGGTGGG + Intronic
930098344 2:47584281-47584303 AACCTTTCACTGCTATTCATGGG + Intergenic
933572172 2:84026521-84026543 AGACTTGGAATAGTATTGATGGG + Intergenic
937432168 2:121848216-121848238 AACCCTGGAACACTGTTGATGGG - Intergenic
940726789 2:157343878-157343900 AACCTTTCACTGCTATTCATGGG - Intergenic
940801049 2:158132903-158132925 AACCCTTGAATACTGTTGATGGG + Intronic
942688065 2:178555037-178555059 AACCTGCGCCTACTATTGAGTGG - Exonic
942905193 2:181172480-181172502 AACCTTGCACTAGTCTTGAAAGG - Intergenic
943938653 2:193960836-193960858 CACCTTGGACTATTATAAATAGG + Intergenic
945372743 2:209040119-209040141 AACCTTTGAATACTACTCATGGG - Intergenic
945858537 2:215094703-215094725 AACCTTTCACTGCTATTCATGGG - Intronic
1172423369 20:34836559-34836581 AACCTAGGACTAGGATTGCTGGG + Intergenic
1176968004 21:15233359-15233381 CCACTTTGACTACTATTGATTGG + Intergenic
1177831974 21:26149136-26149158 AGCCTTGGAATGCAATTGATTGG - Intronic
1182916157 22:34033976-34033998 ATCCTTCGCCTACTTTTGATGGG - Intergenic
951965674 3:28381912-28381934 CACCTTGGCCTCCTATTGCTGGG - Intronic
952135932 3:30419616-30419638 AACCTTTGAATACTGTTGGTGGG + Intergenic
952297567 3:32074646-32074668 AACCTTTCACTGCTATTCATGGG - Intronic
952906826 3:38144918-38144940 AACCTTTGATCACTTTTGATGGG + Intergenic
960797063 3:121498632-121498654 AGGATTGGACTACTATTGATTGG - Exonic
962171862 3:133109612-133109634 AACCTTGGAAAACTAATGAATGG - Intronic
965486492 3:169284747-169284769 CACCTTTGACTCCTAGTGATGGG - Intronic
968412341 4:401108-401130 AACCTTTCACTGCTATTCATGGG + Intergenic
968544048 4:1186907-1186929 AACCCTGGAGAACTATTGATGGG + Intronic
970003922 4:11392703-11392725 TACCTTGGAGAACTATTCATTGG + Intergenic
973207776 4:47579691-47579713 AACCCTGGAGAACTATTGAGTGG + Intronic
975695597 4:77009701-77009723 ATATTTGGACTACTATTGAGAGG + Intronic
976459768 4:85296399-85296421 AACCTTTGTATACTGTTGATGGG + Intergenic
977192380 4:94017075-94017097 AACCCTGGAACACTGTTGATGGG - Intergenic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG + Intronic
978587119 4:110285245-110285267 AACCTTTGTCCACTGTTGATAGG + Intergenic
980424669 4:132612046-132612068 AACATTGCAATTCTATTGATTGG - Intergenic
982989005 4:162246685-162246707 ATCCTTTGCCTACTTTTGATGGG + Intergenic
986488619 5:8266405-8266427 AACCTTGGATTACTATCTACAGG + Intergenic
987013890 5:13797374-13797396 ATCCTTTGCCCACTATTGATGGG - Intronic
989339431 5:40356432-40356454 AAGCTTGGACTGTTGTTGATTGG - Intergenic
993435987 5:87894999-87895021 ACCCTTGGGCCACTATTCATGGG + Intergenic
993561340 5:89414520-89414542 AACCTTTGGCTACTAATGATTGG + Intergenic
995736517 5:115306478-115306500 AACCTTGCAGAAATATTGATAGG - Intergenic
996926253 5:128830000-128830022 AAACATGGACTGCTTTTGATAGG + Intronic
1004144026 6:13047921-13047943 AACCTGGGATTACTCTTGGTGGG - Intronic
1004765224 6:18719264-18719286 ATTCTTGTACTACTATTGCTTGG + Intergenic
1004965848 6:20850208-20850230 AACCTAGTACTACAATTTATTGG - Intronic
1005206774 6:23414043-23414065 AACCAGTGACTACTATTGTTTGG - Intergenic
1015695324 6:135973583-135973605 AACCCTTGTGTACTATTGATGGG - Intronic
1017922119 6:158881916-158881938 AACCTTTCACTGCTATTCATGGG + Intronic
1022749534 7:33209552-33209574 AACCTTCTAACACTATTGATGGG - Intronic
1050064406 9:1743742-1743764 AACCTTGAACAACTAGTAATTGG + Intergenic
1051713799 9:19960498-19960520 AACCTTGGGCTGCTATTGTGTGG + Intergenic
1053307071 9:36992309-36992331 AACCTAGCAATGCTATTGATTGG - Intronic
1055229116 9:74040311-74040333 AACTTTTGACTACTGTTGACTGG - Intergenic
1055638958 9:78304547-78304569 ATCCTTGGACAACTATTTACTGG - Intronic
1060425505 9:123501574-123501596 AACCTTTGGGTACTGTTGATGGG - Intronic
1061015530 9:127979246-127979268 AGCCTTGGACTTCTACAGATGGG - Intronic
1186573535 X:10741150-10741172 AACCTTGGACTATTAAAGCTAGG + Intronic
1189117927 X:38362464-38362486 TCCCTTGGACTACAAGTGATTGG - Intronic
1192763822 X:74123101-74123123 AACCTTTCACTGCTATTGATGGG + Intergenic
1192913740 X:75633126-75633148 AACCTTTCACTGCTATTCATGGG + Intergenic
1193721088 X:84988456-84988478 AGCCTTGGACAAATATTGAGTGG + Intergenic
1195199050 X:102529703-102529725 AAACTTTGACTACAATTGATAGG + Intergenic