ID: 978518023

View in Genome Browser
Species Human (GRCh38)
Location 4:109589763-109589785
Sequence TTGTATCCTCAGGGGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 196}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978518014_978518023 19 Left 978518014 4:109589721-109589743 CCAGTAGGATCTATGAGAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 153
Right 978518023 4:109589763-109589785 TTGTATCCTCAGGGGGTGGCAGG 0: 1
1: 0
2: 1
3: 21
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978518023 Original CRISPR TTGTATCCTCAGGGGGTGGC AGG Intronic
900280101 1:1861578-1861600 TTATATCCTCAGGGGGTTGGGGG + Intronic
900894556 1:5474152-5474174 TTGTGTCCTCATGTGGTGGAAGG - Intergenic
901036991 1:6342210-6342232 GTGTGTCCTCACGTGGTGGCCGG + Intronic
901166641 1:7226075-7226097 TTGGATCCTCAGGGGATGTGGGG - Intronic
901923807 1:12553507-12553529 TTTTGTCCTCAAGGGGTAGCAGG - Intergenic
904173891 1:28611638-28611660 TTCTAGCCTCTGGTGGTGGCTGG - Intronic
904561156 1:31398100-31398122 TTGTATCCCCAGTGCCTGGCAGG - Intergenic
906094295 1:43210291-43210313 TTGTACCCTCAGGGAGAGGTAGG - Exonic
908176351 1:61559022-61559044 TTGTAACCTCACGTGGTGGAAGG + Intergenic
908394620 1:63714080-63714102 CTGTGTCCTCAGGGTGTGGCTGG + Intergenic
908833765 1:68208351-68208373 TTGAATCCTCATCGGGGGGCAGG - Intronic
908842394 1:68293304-68293326 ATGTATCCTGAGGGATTGGCAGG - Intergenic
909863251 1:80634476-80634498 TTATATCCTGAGGGCGTGGGTGG + Intergenic
913124965 1:115778201-115778223 TTGTGTCCTCATGCAGTGGCAGG + Intergenic
913346326 1:117814450-117814472 TTGTATCCTCACATGGTGGAAGG - Intergenic
916501438 1:165390769-165390791 TTGTGTCCTCATGTGGTGGAAGG + Intergenic
916744422 1:167673792-167673814 TTGTAGGCACAGGGGCTGGCTGG - Intronic
920303895 1:205006652-205006674 TTGTATCCACAGGAAGTGGCAGG + Intronic
922113514 1:222586744-222586766 TTTTATTCTAAGGGGGTTGCTGG + Intronic
923404834 1:233649641-233649663 TTGCATCCTCATGTGGTGGAAGG + Intronic
923723478 1:236486962-236486984 TTGCATCCCCAGGGGGTGGCAGG - Intergenic
1063419270 10:5898296-5898318 TTGTGTCCTCACATGGTGGCAGG + Intronic
1067066969 10:43109661-43109683 TGGTGCCCTCAGGGGGAGGCAGG + Intronic
1067836439 10:49644468-49644490 TTAGATCCTCAGGGCATGGCCGG + Intronic
1068568702 10:58604924-58604946 TTGTTTCCTCATGTGGTGGAAGG + Intronic
1068945857 10:62728143-62728165 CTGTTTCCTCATGTGGTGGCAGG + Intergenic
1070149728 10:73798291-73798313 ATGCAACCTCAGGGGGTGTCAGG - Exonic
1072465427 10:95657914-95657936 CTGTATCCTCACGTGGTGGAAGG - Intergenic
1072909674 10:99488576-99488598 TTGTATCCTGTGGGGGAGGGAGG + Intergenic
1072988656 10:100167641-100167663 TTGTTTCCTCAGTGGGTAGATGG - Intronic
1073765308 10:106675865-106675887 CTGTATCCTCACGTGGTGGAAGG - Intronic
1074857811 10:117486236-117486258 TTGCAGCCCCAGGGGGTTGCTGG + Intergenic
1076685018 10:132194611-132194633 TTCTGTGCTCAGAGGGTGGCTGG + Intronic
1076924648 10:133476220-133476242 TTGTTCCATCAGGGGGTGTCAGG - Intergenic
1077548902 11:3190727-3190749 CTGTGTCCTCACGGGGTGGAAGG + Intergenic
1079233292 11:18668606-18668628 ATTTATCCTCAGGGAGAGGCAGG + Intergenic
1083223898 11:61271609-61271631 TTGTCTCCTCTGGGTGAGGCGGG + Intronic
1084621042 11:70270578-70270600 CTGTCTCCTCAGGAGGGGGCGGG - Intergenic
1085446510 11:76604397-76604419 TTGGATCCTCAGGGAGAGGCGGG - Intergenic
1086197557 11:84159147-84159169 GTGTATACTCAGGGAGTGGTTGG - Intronic
1087202927 11:95364320-95364342 ATGTATCTTCAGAGGGTGTCTGG + Intergenic
1087476464 11:98641753-98641775 TTGTATCCTCACATGGTGGAAGG + Intergenic
1088890458 11:114040218-114040240 TTGTGTCCTCACGTGGTGGCAGG + Intergenic
1090320835 11:125842120-125842142 TTGTGTCCTCACATGGTGGCAGG - Intergenic
1096327532 12:50677982-50678004 TAGTCTCCTCAGGGAGTGGTTGG + Intronic
1097249549 12:57625009-57625031 GTGGATCCTCAGGGAGTGGGAGG + Intronic
1097883977 12:64710781-64710803 TTATATCCACTGGTGGTGGCTGG + Intergenic
1098819956 12:75214601-75214623 TTGCATCCTCAGATGGTGGAAGG + Intergenic
1099184737 12:79504564-79504586 TAGTTTCGGCAGGGGGTGGCTGG - Intergenic
1100231645 12:92614621-92614643 TGGCATCCTCTGGGAGTGGCTGG - Intergenic
1101996340 12:109527913-109527935 GTGTCCTCTCAGGGGGTGGCAGG - Intronic
1104415480 12:128594043-128594065 TTGTTTCCTCAGTGGGTGGTGGG - Intronic
1104558818 12:129825532-129825554 TTGTGTCCCCAGGGCATGGCAGG - Intronic
1104593123 12:130100336-130100358 TTGTGTCCTCACGTGGTGGAAGG - Intergenic
1106130243 13:26933705-26933727 CTGTGTCCTCATGGGGTGGGAGG - Intergenic
1110672009 13:78191520-78191542 TTGTATGCTAATGAGGTGGCTGG - Intergenic
1112034402 13:95483979-95484001 CTGTATCCTCATGTGGTGGAAGG - Intronic
1112949214 13:104970018-104970040 TTGAGTCCTCAGGGGGAAGCTGG + Intergenic
1113566927 13:111324912-111324934 TAGAAGCCTCAGGAGGTGGCTGG + Intronic
1114563053 14:23607279-23607301 AGTCATCCTCAGGGGGTGGCAGG - Intergenic
1115913540 14:38283640-38283662 CTGTGTCCTCAGGTGGTGGAAGG - Intergenic
1116394849 14:44435498-44435520 TTGTGTCCTCACAGGGTGGAAGG + Intergenic
1117713030 14:58552001-58552023 GTGGATCCTCAGGGGGAGGCTGG + Intergenic
1118035810 14:61864859-61864881 CTGTCTCCGCCGGGGGTGGCTGG - Intergenic
1121870698 14:97404330-97404352 CTGAATCCTCAGGGCCTGGCAGG + Intergenic
1123943564 15:25228201-25228223 GGGTCACCTCAGGGGGTGGCAGG + Intergenic
1124046789 15:26157883-26157905 TTGTATCCTCACATGGTGGAGGG + Intergenic
1125730569 15:41890606-41890628 TGGGATCTTCAGGGGGTGGCTGG + Intronic
1125987397 15:44067580-44067602 CTGCATCCTCAGAGGGTGGAGGG + Intronic
1127048625 15:55055714-55055736 TTGTATCCTCACAGGGTGGAAGG - Intergenic
1127314618 15:57783110-57783132 TTGTTTCCCCAGGGTGTGGATGG + Intergenic
1127342728 15:58065180-58065202 TAGTATCCTCAGATGGAGGCCGG - Intronic
1127353167 15:58172621-58172643 TTATATCCTCTGGGCATGGCCGG + Intronic
1128950100 15:71870619-71870641 TTGTATCTGCAGGGGGTTGCTGG - Intronic
1130690024 15:86074232-86074254 CTGTATCCTCAGGTGGTGAAAGG + Intergenic
1132863867 16:2084307-2084329 TCGTCTCCTCGGAGGGTGGCCGG + Exonic
1134455265 16:14390713-14390735 TTGTGACCTCAGGGGCTGGCAGG + Intergenic
1135026912 16:19005839-19005861 TCATATCCTCAGGGTGTGCCAGG + Intronic
1135845327 16:25913378-25913400 CTGTGTCCTCAGGTGGTGGAAGG - Intronic
1139674744 16:68515735-68515757 TTGTGTCCTCATGTGGTGGAAGG + Intergenic
1142338893 16:89508155-89508177 TTGTATTCCCAGGGCCTGGCGGG - Intronic
1144011640 17:11154272-11154294 TTGATTCCTTAGGGGATGGCTGG + Intergenic
1144394864 17:14834221-14834243 TTGTATCCCAAGGTGGTGACGGG - Intergenic
1145868509 17:28255849-28255871 TTGGATGCTTAGGGGGTGGGTGG + Intergenic
1148989041 17:51649523-51649545 TTAGATTCTCAGGTGGTGGCTGG - Intronic
1149335735 17:55633882-55633904 TTGTGTCCTCAAGTGGTGGAAGG + Intergenic
1149852758 17:60050206-60050228 CTGTGTCCTCAGGTGGTGGAAGG - Intronic
1152390541 17:80001513-80001535 GAGCATCCTCAGGGGGCGGCGGG + Intronic
1153117109 18:1672094-1672116 TTGTCTTCTCAGGGGATGGGGGG - Intergenic
1153771022 18:8416476-8416498 TTGCAACCCCAGGAGGTGGCAGG - Intergenic
1155776237 18:29765561-29765583 TTGTATCCTCACATGGTGGAAGG + Intergenic
1156742256 18:40345724-40345746 TTGAATCCTCATGAGGTGTCAGG + Intergenic
1157137884 18:45075163-45075185 CTGTATCCTCATGTGGTGGAAGG + Intergenic
1159590774 18:70332740-70332762 TTGTATCCACAGGTGGTGGTTGG - Intergenic
1160706530 19:532540-532562 TTGTCTCCTCCGGGGAGGGCGGG - Intronic
1161470388 19:4454119-4454141 GTGTATCCTCCCGAGGTGGCCGG + Intronic
1163798990 19:19353802-19353824 TAGCATCCTCAGGATGTGGCAGG - Intronic
1164829405 19:31309127-31309149 TTGTGTCTGCAAGGGGTGGCGGG - Intronic
1165730357 19:38141172-38141194 TTTTCTCCCCAGGGGTTGGCCGG + Exonic
1166294138 19:41880788-41880810 GTGTTCCCTCTGGGGGTGGCTGG + Intronic
1168632465 19:57968159-57968181 TTGTGTCCTCACAGGGTGGAAGG + Intronic
925923477 2:8653825-8653847 TTGTAGCCTGAGGGGCTGGATGG + Intergenic
926749742 2:16189233-16189255 TTATCTCTTCAGGGGGTGTCAGG + Intergenic
927871029 2:26623820-26623842 TTGCATCCACTGGGGATGGCTGG - Intronic
930860673 2:56069931-56069953 TTGTATCTTCATGGTGTGACTGG + Intergenic
934619758 2:95796972-95796994 CTGTGTCCTCAGGGTGGGGCAGG + Intergenic
934641130 2:96027585-96027607 CTGTGTCCTCAGGGTGGGGCAGG - Intronic
935099434 2:99978773-99978795 CTGTATCCTCACGTGGTGGGAGG - Intronic
935333822 2:101997067-101997089 TTGTGTCCCCAGGGAGTGGTGGG + Intronic
936713006 2:115154729-115154751 GTGTGTGCTCAGGGGGTGGTGGG - Intronic
937091594 2:119209929-119209951 ATGTACCCTGAGGGTGTGGCAGG - Intergenic
937239270 2:120449903-120449925 GTGTATACTCTGGGGGTGGGTGG + Intergenic
941197224 2:162467899-162467921 TTGCATCCTCAGGTGGTGGAAGG + Intronic
941880752 2:170477768-170477790 ATGTCTCCTGAGGGGGAGGCGGG + Intronic
945313324 2:208341653-208341675 TTGTATTCTCATGTGGTGGAAGG + Intronic
946096279 2:217277224-217277246 CCGTATCCTCAGGTGGTGGAGGG + Intergenic
946153322 2:217790632-217790654 TTTGATCCTAAGGTGGTGGCTGG + Intergenic
947158407 2:227186929-227186951 TTGTGTCCTCACGTGGTGGAAGG + Intronic
948050533 2:234976409-234976431 TTAGATCCTTAGGGGGTGACAGG + Intronic
948803533 2:240443391-240443413 CTGTCTCCTGAGGCGGTGGCTGG + Intronic
1168905904 20:1403573-1403595 CAGTATCATCAGGGTGTGGCTGG + Intergenic
1170797873 20:19565394-19565416 TTGTGTTCTCGGGGGGTGGGGGG + Intronic
1173318778 20:41968968-41968990 GTGTTTCCCCATGGGGTGGCAGG - Intergenic
1173677988 20:44854513-44854535 TTGTATCCTCACATGGTGGCGGG - Intergenic
1173822929 20:46030441-46030463 TGGGAGCCTGAGGGGGTGGCTGG - Intronic
1174105916 20:48161981-48162003 TTTTGTCATCAGGGGGTGGATGG - Intergenic
1174848512 20:53967928-53967950 TTGTTTCCTCAGGCAGGGGCTGG + Intronic
1175054700 20:56187759-56187781 TTTCTGCCTCAGGGGGTGGCTGG - Intergenic
1175075834 20:56372189-56372211 TTGTGTGCTCAGTGGGTGCCAGG - Intronic
1176205239 20:63884671-63884693 GTGTAGCCTCAGGGCATGGCTGG + Intronic
1178895900 21:36556580-36556602 ATGCATCCTCAGTGGGAGGCTGG + Intronic
1178960469 21:37060126-37060148 CTGCATGCTCAGGAGGTGGCAGG - Intronic
1179569833 21:42272226-42272248 TTGAATCCTCAGAGTGAGGCAGG + Intronic
1179994653 21:44968283-44968305 TGGTATCTTCATTGGGTGGCGGG - Intronic
1180708985 22:17826915-17826937 TTGTATGCTCAGAGCCTGGCAGG + Intronic
1181560371 22:23696519-23696541 TTGGATCCCCAGGGAGTGGCGGG - Intronic
1182100001 22:27651015-27651037 TTGTTTCCTCAGAGCCTGGCAGG - Intergenic
1183337988 22:37261648-37261670 CTGTATCCTCACGTGGTGGAGGG - Intergenic
1184050324 22:41999143-41999165 ATGTCTCCTCAGGGCGGGGCGGG + Intronic
952738824 3:36716374-36716396 TTCTGTGCTCAGGAGGTGGCTGG - Intronic
955150912 3:56366388-56366410 TTGTATCTTTGGGGGGTGTCCGG - Intronic
955612889 3:60776140-60776162 TTATATCCTGAGGGCATGGCTGG + Intronic
957285115 3:78207839-78207861 TTGTATCCTCACATGGTGGAAGG - Intergenic
960426192 3:117510450-117510472 TTCCATCCTCAGAGGCTGGCTGG - Intergenic
962122447 3:132576317-132576339 TTATAACCTCAGGGCCTGGCAGG + Intronic
967248394 3:187512506-187512528 TTGTATCCTCAGGTGGCAGAGGG + Intergenic
971443678 4:26718484-26718506 TTGTATCTTCAGATGATGGCAGG - Intronic
973830971 4:54758459-54758481 TAGAATCTTCAGAGGGTGGCTGG - Intergenic
974891196 4:67886086-67886108 TTAGATCCTCAGGGAGTGGCAGG + Intergenic
977605342 4:98978971-98978993 ATGTATCCTCACGTGGTGGAAGG + Intergenic
978518023 4:109589763-109589785 TTGTATCCTCAGGGGGTGGCAGG + Intronic
978740507 4:112132496-112132518 TTGTGTCCTCATGGGGTGGAAGG + Intergenic
981485023 4:145276855-145276877 TAGTTTTCTCAGCGGGTGGCCGG - Intergenic
982962490 4:161858161-161858183 TTTTATCCTCACGTGGTGGAAGG - Intronic
983848564 4:172549818-172549840 TTGTATCGTCTAGGGGTGGAAGG - Intronic
984856724 4:184201743-184201765 TTTTTTCCTCAGGGCATGGCTGG + Intronic
985556221 5:559206-559228 TTGTTTCCTTGGAGGGTGGCAGG + Intergenic
985668787 5:1195874-1195896 CTGTGTCCCCAGGGGGTGGGAGG - Intergenic
986688338 5:10293390-10293412 TTGTGTCCTCACGGGGTAGAAGG + Intronic
990925204 5:61014042-61014064 TTGTATGCTCATGAGATGGCTGG + Intronic
991550087 5:67826167-67826189 TTGAAACCCCAGGGGATGGCTGG + Intergenic
993858704 5:93107457-93107479 TTGTATCCTGGGGTGGGGGCAGG - Intergenic
994214936 5:97127032-97127054 TTGTTTCCTCAGGGGTGGGAGGG - Intronic
995063388 5:107835500-107835522 TTTAATCCTCATGGGGTGGGAGG + Intergenic
995995172 5:118289642-118289664 CTGTAATCTCAGGGGGTGGTTGG + Intergenic
996342568 5:122454696-122454718 TTCTTGCCTCAGGGGGTTGCTGG - Intronic
996701253 5:126452248-126452270 TTGGATCCTCATGTGGTGGAAGG + Intronic
997056918 5:130454241-130454263 TTGCATCCTCATGTGGTGGAAGG - Intergenic
998401972 5:141852917-141852939 AGGTTTGCTCAGGGGGTGGCTGG - Intergenic
999200643 5:149813876-149813898 TTGTATTCTCACAGGGTGGGAGG + Intronic
999883896 5:155898707-155898729 CTGTATCCTGAGGGGATGGCTGG - Intronic
1000828818 5:166078619-166078641 TAGCATCCTCAGGGGAGGGCCGG - Intergenic
1001756854 5:174176994-174177016 TTGCATCCTCACGTGGTGGAAGG + Intronic
1004605783 6:17194017-17194039 TTGTATGCTAAGGAGGTGACTGG + Intergenic
1007953030 6:45889253-45889275 TTGTATCCTCACATGGTGGAGGG + Intergenic
1010934338 6:81843549-81843571 TGGTTTCCACAGTGGGTGGCTGG - Intergenic
1011814528 6:91172990-91173012 TTTTTTCCACAGAGGGTGGCTGG + Intergenic
1012986018 6:105877246-105877268 TTGTATCCTCACGTGGTAGAAGG + Intergenic
1014332931 6:120093641-120093663 TTGTATTCTCAGTGTGTAGCTGG + Intergenic
1019100876 6:169628178-169628200 CTGTATCCTCAAGTGGTGGATGG - Intronic
1019814733 7:3191175-3191197 TTGTGTCCTCATGCGGTGGAAGG - Intergenic
1019954718 7:4404606-4404628 TTGTATCCCCAGGGCCTGGCTGG + Intergenic
1020901553 7:14009659-14009681 TAGTATCCTGAGGGGCTGGATGG - Intergenic
1021864162 7:24938251-24938273 TTGTGTCCTCACGTGGTGGAAGG - Intronic
1021927726 7:25549477-25549499 TTTTATCCTCAGGTGGGGGAGGG + Intergenic
1023802731 7:43849105-43849127 TTATAGCCTCAGGAGGGGGCTGG + Intergenic
1024059930 7:45690115-45690137 TTGCATGGTCAGGGGCTGGCAGG + Intronic
1026241948 7:68583387-68583409 CTGTATCCTGAGGGCGTGGGTGG - Intergenic
1029877450 7:103769348-103769370 CTGTATCCTCACGTGGTGGAAGG - Intronic
1032526097 7:132579040-132579062 TTGTATCCTCAGTGCCCGGCTGG - Intronic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1037475458 8:19252655-19252677 TTGTGTTCTCAAGTGGTGGCAGG + Intergenic
1037496241 8:19443767-19443789 TGGTATCCCCAGGGGGTTTCTGG - Intronic
1038067396 8:23977163-23977185 TTTTTTCCTCAGGGGGTCCCCGG - Intergenic
1042211887 8:66389453-66389475 TTGTGTCCTCACAGGGTGGAAGG + Intergenic
1047002786 8:120589655-120589677 TTGTATCCTCATATGGTGGAAGG + Intronic
1047295551 8:123567606-123567628 TTGCATCCTCAAGTGGTGGAAGG + Intergenic
1047323901 8:123818170-123818192 ATGTGTCCTCACGGGGTGGAGGG + Intergenic
1047742387 8:127817008-127817030 TTGTATCGGGAGGGGGTGGGGGG - Intergenic
1048746849 8:137624124-137624146 TTATATCCTCTGGTGGTTGCTGG + Intergenic
1049957714 9:708754-708776 TTGTATACTCAGGAGAGGGCAGG + Intronic
1050614319 9:7386128-7386150 GTTTATTTTCAGGGGGTGGCTGG + Intergenic
1051029039 9:12651894-12651916 TTGCATCCTCATGGAGTGGAAGG - Intergenic
1051861212 9:21627236-21627258 TTGTATCCTCACATGGTGGAAGG - Intergenic
1052758993 9:32570261-32570283 TTAGATCCTCAGTGGGTTGCAGG - Intronic
1053378638 9:37630002-37630024 CTGTATCCTCATGGAGTGGAAGG + Intronic
1055681475 9:78720264-78720286 TTGTAACCTCACGTGGTGGAAGG + Intergenic
1056306485 9:85295602-85295624 TGGTATCCTCCAGGGGTGGGTGG - Intergenic
1057142713 9:92737291-92737313 TCCTATCGTCAGGGGGTGGGTGG - Intronic
1062672421 9:137719359-137719381 CTGGCTCCTCAGGGGGTGGTGGG + Intronic
1190324554 X:49199023-49199045 TTCTCTCCTCAGCTGGTGGCTGG - Exonic
1191150010 X:57210190-57210212 TTGTGTCCTTATGGGGTGGAGGG + Intergenic
1192275268 X:69623366-69623388 CTGTATCCTCACGTGGTGGAAGG + Intronic
1194438994 X:93906208-93906230 TTGTAGCCTCGCTGGGTGGCTGG - Intergenic
1196704651 X:118706572-118706594 TTCTAACCTCAGGGGCTGGCTGG + Intergenic
1198033260 X:132776102-132776124 TTGTATGATCATGGGGTGGATGG + Intronic
1200215520 X:154366514-154366536 TTGTGACCTCAGGCAGTGGCTGG - Intronic
1201492271 Y:14555368-14555390 TTGTATCCTCATGTGGTGGAAGG + Intronic
1201906414 Y:19090263-19090285 TTGTATCCTCACATGGTGGAAGG - Intergenic