ID: 978518327

View in Genome Browser
Species Human (GRCh38)
Location 4:109593312-109593334
Sequence GTTACTTTACAACCAAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978518327_978518333 23 Left 978518327 4:109593312-109593334 CCAGTCTTTGGTTGTAAAGTAAC 0: 1
1: 0
2: 1
3: 10
4: 92
Right 978518333 4:109593358-109593380 AGTTATTTCCAGTTTTCCCATGG No data
978518327_978518334 29 Left 978518327 4:109593312-109593334 CCAGTCTTTGGTTGTAAAGTAAC 0: 1
1: 0
2: 1
3: 10
4: 92
Right 978518334 4:109593364-109593386 TTCCAGTTTTCCCATGGAGTTGG No data
978518327_978518335 30 Left 978518327 4:109593312-109593334 CCAGTCTTTGGTTGTAAAGTAAC 0: 1
1: 0
2: 1
3: 10
4: 92
Right 978518335 4:109593365-109593387 TCCAGTTTTCCCATGGAGTTGGG 0: 1
1: 0
2: 1
3: 13
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978518327 Original CRISPR GTTACTTTACAACCAAAGAC TGG (reversed) Intronic
902201741 1:14838583-14838605 CTAACCTTACAACCAAAGAATGG - Intronic
906823751 1:48956407-48956429 GTTACATTACAACCAATCAATGG + Intronic
906892615 1:49733793-49733815 TTTACTCTACAACCAAAGCCAGG + Intronic
908066477 1:60411102-60411124 GTTAATTTAGAACTAAATACAGG - Intergenic
908123603 1:61008309-61008331 TTGACTTTACAACCACAGAAGGG - Intronic
908230062 1:62095675-62095697 GATACTTTACAAAAAAAAACTGG - Intronic
908692017 1:66792579-66792601 ATTACTTTAGAACCAAATAAAGG + Intergenic
911278335 1:95892390-95892412 ATTTCTTTATAACTAAAGACTGG + Intergenic
911981093 1:104567918-104567940 TTTCCTTTAGAACCAATGACTGG - Intergenic
917221702 1:172737541-172737563 GTTACTTGAGAAACTAAGACAGG - Intergenic
917687850 1:177435971-177435993 AATACTTAAAAACCAAAGACAGG - Intergenic
917824185 1:178799559-178799581 ATTATTTTACATCCAAAGACGGG - Intronic
919014938 1:192020366-192020388 CTTACGTTAAAAACAAAGACAGG + Intergenic
921477088 1:215624420-215624442 GTGAATCTACAACCAGAGACAGG - Exonic
1063544098 10:6962995-6963017 GACACATTAAAACCAAAGACAGG - Intergenic
1063793239 10:9479445-9479467 CCTACTTTCCATCCAAAGACAGG + Intergenic
1069589123 10:69630940-69630962 GTTACTTTACAACCACTGCCTGG - Intronic
1070524987 10:77288470-77288492 ATTAACTTACAACCAAAGGCTGG + Intronic
1075352575 10:121737108-121737130 GTTATTTTACTAACAAAGCCAGG - Intergenic
1081063930 11:38515807-38515829 ATTATTTTAGATCCAAAGACAGG - Intergenic
1082946848 11:58770580-58770602 GTTACAGGACAATCAAAGACTGG - Intergenic
1083134528 11:60659431-60659453 TGTACTTTTCAACCAAAAACAGG + Intergenic
1092442290 12:8517086-8517108 GTTACTTTAAAAGCCAAGAGTGG + Intronic
1093677432 12:21960055-21960077 TTTATTTTACAACTAAGGACTGG - Intergenic
1095361984 12:41353445-41353467 GTGACTTTATAACGAAAGATAGG + Intronic
1097992884 12:65854874-65854896 GTAACTGCACAGCCAAAGACAGG - Intronic
1098592566 12:72231159-72231181 TTTATGTTACAACCAAGGACAGG + Intronic
1103412037 12:120719328-120719350 TTTACTTTAGATCCCAAGACAGG + Intronic
1110817224 13:79875630-79875652 CTTACTCTAATACCAAAGACTGG + Intergenic
1114962556 14:27911780-27911802 ATTATTGTACAACCAAAGGCTGG + Intergenic
1117496986 14:56315249-56315271 GCTATTGTAAAACCAAAGACTGG + Intergenic
1119629786 14:76219028-76219050 GTTATTTTATAACCTAAGACTGG + Intronic
1120550140 14:85860687-85860709 GTTACTTAAAAAACAAACACTGG + Intergenic
1128447512 15:67776994-67777016 GTTTCTTTTCATCCAAAAACAGG + Intronic
1128455867 15:67831021-67831043 CTTACTTTCCACCCAAAGAAAGG - Intronic
1128458289 15:67845644-67845666 ATTGCTATACAACAAAAGACAGG + Intergenic
1128494139 15:68181993-68182015 GTTGCATTACAACTAAAGTCAGG - Intronic
1130934062 15:88453983-88454005 GTTGCTTTACAGCCAAGCACTGG - Intergenic
1134187067 16:12092791-12092813 GTTTCTTTGATACCAAAGACAGG + Intronic
1136482959 16:30554177-30554199 GATATTTTACAACCAAATACAGG - Exonic
1136988039 16:35130179-35130201 GTTTCTTTAAAATGAAAGACAGG - Intergenic
1140755841 16:78065874-78065896 GTGACTTAACAGTCAAAGACAGG - Intronic
1141016760 16:80458111-80458133 GCTATTGTAAAACCAAAGACTGG - Intergenic
1143304760 17:5937583-5937605 GTTATATTACAACAAAAGACGGG + Intronic
1146303929 17:31715366-31715388 GTTACTCTACAGGCTAAGACAGG - Intergenic
1155560644 18:27072749-27072771 GTTACTTTAAAGCCATAAACTGG - Intronic
1158240212 18:55369058-55369080 GATACTATATAACAAAAGACTGG + Intronic
1163174144 19:15552454-15552476 GTTTATTTACAACCCAGGACAGG + Intergenic
1164054547 19:21611052-21611074 GGTAGTTGACAACCAAACACTGG - Intergenic
1167730522 19:51250991-51251013 CTTATTTTACAACCAATGAGAGG - Intronic
929511029 2:42566241-42566263 GAAACCTTTCAACCAAAGACGGG - Intronic
930728356 2:54704559-54704581 GTAACTGTGCAACCAAAGAAAGG + Intergenic
932017423 2:68045631-68045653 GTTGATTTACTAGCAAAGACGGG - Intronic
932874650 2:75438058-75438080 GTTACTTTAAAAGCCAAGAGTGG - Intergenic
933391334 2:81671960-81671982 GTTCCTTTCCAACCATAGATTGG - Intergenic
933827100 2:86172263-86172285 GTTACTTTAAAACCAAGGCCGGG - Intronic
937132436 2:119523738-119523760 GTCACTTTACAGACAAAGAAAGG - Intronic
941476231 2:165954103-165954125 CTTCCTTTACAACCAGTGACAGG - Intergenic
941828737 2:169929977-169929999 AATACTTTCCAACCAGAGACTGG - Intronic
942797102 2:179834519-179834541 GATATTTTAAAACGAAAGACGGG + Intronic
1175266598 20:57707254-57707276 GTTTCTTTACACCAAAAGATAGG - Intronic
1181502522 22:23325492-23325514 GTTATTTCACAGCAAAAGACTGG - Intergenic
952489212 3:33850200-33850222 GTTACTGTGCAATCAAGGACAGG - Intronic
957504879 3:81107026-81107048 CTTACTTTATAACCCATGACTGG - Intergenic
960546989 3:118926686-118926708 GTTACTTTACAAACAAAAACTGG + Intronic
964025804 3:152072586-152072608 ATTTCTTTTCAACCAAAGGCTGG - Intergenic
967378933 3:188835858-188835880 GTTTCTTTACATATAAAGACTGG - Intronic
970589077 4:17543647-17543669 GTTATTGTATAACCAATGACTGG + Intergenic
971759645 4:30748795-30748817 GTTCCTGTACATCCCAAGACGGG - Intronic
974863500 4:67552118-67552140 GTGGCTTGACAGCCAAAGACAGG + Intergenic
975325820 4:73057560-73057582 GTAACTTTATAAACAGAGACAGG + Exonic
977195153 4:94049099-94049121 GTTACTTCACAACAACAAACAGG - Intergenic
977772167 4:100872565-100872587 GTTAGTGTACAACCCAAGAATGG - Intronic
977945371 4:102907234-102907256 GTTACTTTACAGACAAAATCTGG - Intronic
978518327 4:109593312-109593334 GTTACTTTACAACCAAAGACTGG - Intronic
978954307 4:114595838-114595860 GTTACAAGACAATCAAAGACTGG + Intergenic
980699437 4:136405060-136405082 GCTACTGTTCAACCAAAGCCAGG + Intergenic
983762070 4:171423330-171423352 GATATTTTTCAACCAAAGGCAGG + Intergenic
984055286 4:174921062-174921084 CTTACTGTAGAACCAAAGACTGG - Intronic
984079334 4:175225085-175225107 TTTACATTTCTACCAAAGACAGG - Intergenic
985042304 4:185903789-185903811 AATCCTTTACAACCAAAGCCAGG - Intronic
991404370 5:66287676-66287698 TTTATTTTACAATCAAAGATGGG - Intergenic
991724373 5:69521163-69521185 GTTATTTTAAAACCAAAAATAGG + Intronic
994278626 5:97871098-97871120 CTTATTTTACACCCAAAGAATGG - Intergenic
994691040 5:103019862-103019884 ATTACTATAAAACCAAAGTCTGG + Intronic
995504798 5:112848977-112848999 GTTACTTCAGGACCAAAGAGGGG - Intronic
995504930 5:112850431-112850453 GTTACTTTAGGAACAAAGAGGGG - Intronic
997491102 5:134276827-134276849 ATTAGTATTCAACCAAAGACTGG + Intergenic
1014189063 6:118471107-118471129 ATTACTATACAATGAAAGACGGG - Intronic
1015703095 6:136057565-136057587 TTTAGTTGACAACCAAATACTGG - Intronic
1018201673 6:161401156-161401178 GATACTTTACATGCAAAAACAGG - Intronic
1029227074 7:99035961-99035983 GTTATTTTATAACCAAAGCGGGG + Intronic
1029564257 7:101324884-101324906 CTCACTTTACAATCAAAGCCTGG - Intergenic
1030019808 7:105262244-105262266 GTTAGTTTCCAATGAAAGACTGG - Intronic
1034228197 7:149498466-149498488 GTTATTTTTAAAACAAAGACAGG - Intergenic
1034243293 7:149625412-149625434 GTTAATTTTAAAACAAAGACAGG - Intergenic
1041675367 8:60533070-60533092 GTTATTTTACAAGCAAATACTGG - Intronic
1044957042 8:97491899-97491921 GTTAATTTACATCCTAAGATAGG - Intergenic
1045793030 8:106008737-106008759 GACACTTCACAGCCAAAGACTGG - Intergenic
1050230430 9:3518808-3518830 GTTACTTTACAACTCAAGATTGG + Intronic
1051010684 9:12409816-12409838 GCAACTTGAAAACCAAAGACTGG - Intergenic
1057972519 9:99571420-99571442 CTTCCTTTACAAGCAAAGCCAGG + Intergenic
1192030229 X:67503305-67503327 CCTACTTTTCAACCAAGGACAGG + Intergenic
1198971352 X:142284029-142284051 GCAACTATACAACCAATGACAGG - Intergenic