ID: 978520399

View in Genome Browser
Species Human (GRCh38)
Location 4:109609586-109609608
Sequence TCCTGGGAATGTAGTCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978520395_978520399 10 Left 978520395 4:109609553-109609575 CCTATCTCATTCTGTGACTTAGA 0: 41
1: 550
2: 805
3: 598
4: 484
Right 978520399 4:109609586-109609608 TCCTGGGAATGTAGTCCAGCAGG No data
978520394_978520399 13 Left 978520394 4:109609550-109609572 CCTCCTATCTCATTCTGTGACTT No data
Right 978520399 4:109609586-109609608 TCCTGGGAATGTAGTCCAGCAGG No data
978520392_978520399 30 Left 978520392 4:109609533-109609555 CCTATATCTTGTGCCGACCTCCT 0: 9
1: 161
2: 598
3: 726
4: 523
Right 978520399 4:109609586-109609608 TCCTGGGAATGTAGTCCAGCAGG No data
978520393_978520399 17 Left 978520393 4:109609546-109609568 CCGACCTCCTATCTCATTCTGTG 0: 23
1: 278
2: 432
3: 294
4: 411
Right 978520399 4:109609586-109609608 TCCTGGGAATGTAGTCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978520399 Original CRISPR TCCTGGGAATGTAGTCCAGC AGG Intronic