ID: 978522541

View in Genome Browser
Species Human (GRCh38)
Location 4:109631723-109631745
Sequence CCACCATGCATTGTCTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 301}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978522541_978522543 -9 Left 978522541 4:109631723-109631745 CCTGGGGAGACAATGCATGGTGG 0: 1
1: 0
2: 1
3: 19
4: 301
Right 978522543 4:109631737-109631759 GCATGGTGGCAACAGTAGATCGG 0: 1
1: 0
2: 0
3: 5
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978522541 Original CRISPR CCACCATGCATTGTCTCCCC AGG (reversed) Intronic
900141804 1:1141824-1141846 CAACCATGCAGGGTCTCCCCCGG - Intergenic
900394775 1:2448756-2448778 CCACCATCCAGTCTCTCCCTGGG + Intronic
901437069 1:9253644-9253666 CCAGTGTGCGTTGTCTCCCCAGG + Intronic
902834315 1:19036815-19036837 CCACCATGCCTTGCCTCCTCTGG + Intergenic
902964607 1:19990564-19990586 CCAACATGTGATGTCTCCCCTGG + Intergenic
902998460 1:20246774-20246796 CCACCATGCCTGGTCACCCTTGG + Intergenic
903270763 1:22186827-22186849 CCACCATGCCTGGCCTCACCTGG + Intergenic
904783924 1:32971386-32971408 CCTCCATCCTTTGTGTCCCCAGG + Intergenic
904912335 1:33944773-33944795 CCAACCTGCATTGTAGCCCCGGG - Intronic
905628549 1:39505289-39505311 CCACAGTGCATTGTGTCCCTGGG + Intronic
907060524 1:51418429-51418451 ACACTGTGCATTTTCTCCCCAGG - Intronic
907373799 1:54019496-54019518 CCACCATGCCTGGCCTCCTCTGG - Intergenic
909023512 1:70458437-70458459 CCAGCATGCATCTTCTTCCCAGG + Intergenic
909254968 1:73408249-73408271 CCAACATGTGATGTCTCCCCTGG + Intergenic
912097385 1:106161920-106161942 CCAACATGTGATGTCTCCCCTGG + Intergenic
912733289 1:112128537-112128559 CCACCCTGCCTTGTCTTCCTCGG - Intergenic
913355952 1:117922588-117922610 CCAACATGTGATGTCTCCCCTGG - Intronic
915349918 1:155217875-155217897 TCACCATGGAGTTTCTCCCCTGG - Intergenic
916468125 1:165092857-165092879 CCACAGTGCATTGTGTCCCTGGG - Intergenic
916817672 1:168369473-168369495 CCACCATTCACTGTCTTCTCAGG + Intergenic
916832563 1:168508032-168508054 CCACCCTGAATTCCCTCCCCAGG + Intergenic
917078368 1:171229906-171229928 CCACCATGCCTGGTCTCATCAGG - Intergenic
917266246 1:173223853-173223875 CCACCACCCATTCTTTCCCCTGG - Intergenic
917312994 1:173696145-173696167 CCAACATGTGATGTCTCCCCCGG + Intergenic
919231364 1:194779207-194779229 CAACCACTCATTGCCTCCCCTGG - Intergenic
919383331 1:196886423-196886445 CCAACATGTGATGTCTCCCCTGG - Intronic
923076914 1:230617836-230617858 CTTCCATGCACTGTCTCTCCCGG - Intergenic
924845286 1:247762506-247762528 CCACCACACATTGTCTCCTTCGG - Intergenic
924869664 1:248027530-248027552 CCAACATGTGATGTCTCCCCCGG + Intronic
1065432553 10:25674181-25674203 CCAACATGTGATGTCTCCCCCGG + Intergenic
1065936258 10:30523075-30523097 CCAACATGTGATGTCTCCCCTGG + Intergenic
1066957653 10:42188344-42188366 CCACCCTGCCTTCTCTCCCACGG + Intergenic
1068880453 10:62043107-62043129 CCACCAAGAATGGTTTCCCCTGG + Intronic
1069615777 10:69805290-69805312 CCCCCATTCATTGTCCCCTCTGG - Intronic
1070854927 10:79600082-79600104 CCAACATGTGATGTCTCCCCCGG + Intergenic
1071945489 10:90639069-90639091 CCAACATGTGATGTCTCCCCTGG + Intergenic
1073027265 10:100497143-100497165 CCACCAGGCTTTGTCCCCCATGG - Exonic
1074211710 10:111341274-111341296 CCAACATGCGATGTCACCCCTGG - Intergenic
1076622214 10:131797880-131797902 CCAGTATGCTTTGGCTCCCCAGG + Intergenic
1077473657 11:2776453-2776475 GCACCAGGCAGTGTCTTCCCAGG - Intronic
1078457150 11:11484303-11484325 CCACCATGCCTGGCCTCACCTGG - Intronic
1078654534 11:13226032-13226054 CCACCATGCTTCCTCTCCCATGG + Intergenic
1078659989 11:13278387-13278409 CCACCAGGCATGGTCCCCTCGGG - Intronic
1079505768 11:21150423-21150445 CCACCATGCAGAGTGTCCCTTGG + Intronic
1079877627 11:25879304-25879326 CCAACATGTGATGTCTCCCCCGG + Intergenic
1082662047 11:55924023-55924045 CCAACATGTGATGTCTCCCCTGG - Intergenic
1082728708 11:56768888-56768910 CCAGCACTCATTGTTTCCCCTGG + Intergenic
1084097969 11:66924952-66924974 CCAACATGTGATGTCTCCCCTGG - Intronic
1084238062 11:67800867-67800889 CCGCCCTGCATTGTCTCCCATGG + Intergenic
1084608036 11:70183962-70183984 CCACCTTGCTGTGTGTCCCCTGG - Intronic
1084834349 11:71791967-71791989 CCGCCCTGCACTGTCTCCCATGG - Intronic
1085647053 11:78231294-78231316 CCACCATACAGTCTCTCCCTTGG + Intronic
1085959427 11:81443233-81443255 CCAACATGTGATGTCTCCCCCGG - Intergenic
1086834150 11:91600656-91600678 CCACCCTGCCTTCTCTCCCCAGG + Intergenic
1089622154 11:119728424-119728446 CCCCCATCCAATGCCTCCCCGGG - Intronic
1090099130 11:123775348-123775370 TCACCATGCATTTCCTCCCCAGG - Intergenic
1090283875 11:125481804-125481826 GCTCCATGCACTTTCTCCCCTGG - Intronic
1091121359 11:133060578-133060600 CCACCAGGCCTTGGCTCCCCAGG + Intronic
1092155919 12:6281395-6281417 CCACCATGCACAGTCTCCAGTGG + Intergenic
1092408732 12:8238497-8238519 CCACCCTGCACTGTCTCCCATGG + Intergenic
1094385023 12:29884895-29884917 CCAACATGTGATGTCTCCCCTGG - Intergenic
1094579847 12:31724429-31724451 CCACCCTGCCCTGTCTGCCCAGG - Intronic
1096407749 12:51356031-51356053 CTACCATGCATGGTCTCCTGGGG + Intronic
1097814445 12:64056770-64056792 CCACCAAGCTTTTTCTCGCCTGG + Intronic
1098781120 12:74687714-74687736 CCAACATGTGATGTCTCCCCCGG - Intergenic
1098960603 12:76736098-76736120 CCAACATGTGATGTCTCCCCTGG + Intergenic
1099375682 12:81894223-81894245 CCACCCTGCCTTCTCTCCCACGG + Intergenic
1100349538 12:93766283-93766305 CCACCATGCAGTGTCTTCTTTGG + Intronic
1101316035 12:103629681-103629703 CCACCTGGCATGGTCTTCCCTGG + Intronic
1101500555 12:105300160-105300182 CCAACATGTGATGTCTCCCCTGG + Intronic
1102030660 12:109738365-109738387 CCAGCATTCATTCTCTTCCCCGG + Intronic
1103812961 12:123630515-123630537 AGACCCTGGATTGTCTCCCCTGG + Exonic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1106610878 13:31279445-31279467 CCAACATGTGATGTCTCCCCCGG - Intronic
1107873445 13:44768143-44768165 CCCAAATCCATTGTCTCCCCAGG - Intergenic
1109044143 13:57386417-57386439 AGACCATGTATTGTCTTCCCTGG + Intergenic
1110463967 13:75779932-75779954 CCAACATGTGATGTCTCCCCCGG - Intronic
1110819488 13:79897834-79897856 CCACCATGCCTTGTCACTCTGGG + Intergenic
1111468245 13:88644939-88644961 CCAACATGGGATGTCTCCCCCGG - Intergenic
1112746611 13:102534029-102534051 CCAACATGTGATGTCTCCCCTGG + Intergenic
1113271764 13:108682421-108682443 CCACCGAGAATTGTCTCCCTGGG - Intronic
1113337341 13:109389710-109389732 CCACCATGGAATGTGTCACCTGG + Intergenic
1114632565 14:24168788-24168810 CCACCATGCCTGGCCTCACCTGG - Intergenic
1114892384 14:26941975-26941997 CCGACATGTGTTGTCTCCCCCGG - Intergenic
1116301746 14:43192126-43192148 CCGACATGTAATGTCTCCCCTGG - Intergenic
1116562789 14:46402571-46402593 CCAACATGTGATGTCTCCCCCGG + Intergenic
1116857039 14:49961718-49961740 CTTCCATGCAGTGTTTCCCCAGG + Intergenic
1118116313 14:62781143-62781165 CCAACATGTGATGTCTCCCCTGG - Intronic
1118372149 14:65146457-65146479 CCAACATGTGATGTCTCCCCTGG - Intergenic
1119382080 14:74235633-74235655 CCACAATGTATTGAGTCCCCAGG + Intergenic
1119573300 14:75695577-75695599 CCAACATGTGATGTCTCCCCTGG + Intronic
1122344887 14:101052287-101052309 CAACCATGCATTCTTGCCCCTGG - Intergenic
1202935448 14_KI270725v1_random:83432-83454 CCACCCTGCTTTCTCTCCCATGG - Intergenic
1123817157 15:23991778-23991800 ACAGCATGCAATGTCTGCCCTGG - Intergenic
1123830141 15:24127675-24127697 CCTCCCTGCTTTGTCTCCCAGGG + Intergenic
1123845046 15:24291612-24291634 CCTCCCTGCTTTGTCTCCCAGGG + Intergenic
1123860202 15:24458288-24458310 CCTCCCTGCTTTGTCTCCCAGGG + Intergenic
1127123953 15:55794281-55794303 CCACCATGCAGAGTCTCTACTGG + Intergenic
1127899782 15:63332539-63332561 CCACCACCCATTCTTTCCCCAGG - Intronic
1129902313 15:79160381-79160403 CCACCATGCAGTGACTCACAGGG - Intergenic
1131382650 15:91976716-91976738 CCAACATGTGATGTCTCCCCCGG - Intronic
1133349697 16:5093314-5093336 CCGCCCTGCACTGTCTCCCATGG + Intronic
1134642423 16:15839760-15839782 CCACCGTGCATGGCCTCCTCTGG - Intronic
1135585295 16:23665698-23665720 CCACCATTCACTGTCTTCTCAGG + Exonic
1136075116 16:27811936-27811958 CCACCATGCCTGGTCTCTCCTGG + Intronic
1138093060 16:54192385-54192407 CCACAATGCCTTGTATGCCCTGG - Intergenic
1139078678 16:63486805-63486827 CCACCACGCAGTGTTTCTCCTGG + Intergenic
1139202844 16:64996692-64996714 CCACCATGCATAGTATTCCATGG - Intronic
1139954641 16:70687222-70687244 GCACCATGCACTGCCTGCCCTGG - Intergenic
1141118182 16:81329793-81329815 TCACCCTGCACTGTCTCCCACGG + Intronic
1141429722 16:83965368-83965390 CCACCATGAGCTGTCTGCCCTGG + Exonic
1144196708 17:12901673-12901695 TCACCCTGCATTTTCTCCCCAGG - Intronic
1144747891 17:17627790-17627812 CCACCATGCCTGGCCTCACCTGG + Intergenic
1146427048 17:32750324-32750346 CCACCACGCCTGGCCTCCCCAGG - Intronic
1147000928 17:37361320-37361342 CCACCACGCCAAGTCTCCCCAGG + Intronic
1147772335 17:42876689-42876711 CCACCATGCCTGGACTGCCCTGG + Intergenic
1148229683 17:45924089-45924111 CAACCAAGCTCTGTCTCCCCTGG + Intronic
1149567523 17:57650554-57650576 TCACCATGCATGGTCTCCATGGG + Intronic
1150807650 17:68331787-68331809 CCAACATGTGATGTCTCCCCCGG - Intronic
1152031294 17:77845107-77845129 CCACCATGCTTGGCCTCCCTGGG - Intergenic
1152117151 17:78395420-78395442 CCACCCTGCATTGTCAACACAGG - Intronic
1152238556 17:79150567-79150589 GCACCTCCCATTGTCTCCCCTGG - Intronic
1153620603 18:6974068-6974090 CCACCATGCCTGGTCTCCAAAGG + Intronic
1153942599 18:9990789-9990811 CCACCAGCCATTGTCTGTCCAGG + Intergenic
1153949570 18:10046654-10046676 CCACTCTACCTTGTCTCCCCAGG + Intergenic
1153967041 18:10191458-10191480 CCACCATGCTGTTTCTCGCCTGG + Intergenic
1156883945 18:42112510-42112532 CCAACATGTGATGTCTCCCCAGG + Intergenic
1157126056 18:44957190-44957212 TGACTATGCATTGTCACCCCTGG - Intronic
1157250160 18:46088584-46088606 CCACAGTGCATTGTGTCCCTGGG - Intronic
1157814642 18:50721916-50721938 CCATCTGGCATTGCCTCCCCAGG + Exonic
1158113065 18:53963201-53963223 CCAACATGTGATGTCTCCCCTGG + Intergenic
1158390812 18:57043544-57043566 CCACCATTCACTGTGTCCCAAGG + Intergenic
1161451063 19:4345683-4345705 CCACCATGCCCTCTCTCCCGGGG - Intronic
1162281061 19:9698379-9698401 CCAACATGTGATGTCTCCCCCGG + Intronic
1163311463 19:16517472-16517494 CCACCATGGAATGTCACACCTGG - Intronic
1164377686 19:27703570-27703592 CCCACATGTGTTGTCTCCCCTGG - Intergenic
1166601958 19:44104088-44104110 CCACCTTTCATTGTCTCATCAGG + Intronic
1166942334 19:46374410-46374432 CCACCATCCTTAGCCTCCCCAGG - Intronic
1167368240 19:49065602-49065624 CCCACATCCACTGTCTCCCCGGG - Intergenic
1167940933 19:52945272-52945294 CCACAGTGCATTGTGTCCCTGGG + Intronic
1167951140 19:53028585-53028607 CCGCAGTGCATTGTGTCCCCGGG + Intergenic
1168702029 19:58446217-58446239 CCATCATGGAGTGTCTCCTCAGG - Intergenic
927240962 2:20919212-20919234 CCAACCTGCATTATCTACCCAGG - Intergenic
927494354 2:23542641-23542663 CCTTCCTGCATTCTCTCCCCAGG + Intronic
930161902 2:48167062-48167084 CCAACATGTGATGTCTCCCCTGG - Intergenic
930295375 2:49547247-49547269 CCACCCTGCCTTCTCTCCCCTGG - Intergenic
931205423 2:60141138-60141160 CCTCCATACGTTGTCTCCCTGGG - Intergenic
933486449 2:82930528-82930550 CCACCTTGCAGTGTCTCCTCAGG + Intergenic
934305773 2:91820858-91820880 CCACCCTGCCTTCTCTCCCGCGG + Intergenic
934327483 2:92031884-92031906 CCACCCTGCCTTCTCTCCCGCGG - Intergenic
934465870 2:94262464-94262486 CCACCCTGCCTTCTCTCCCACGG - Intergenic
934844859 2:97656262-97656284 CCACCGTGCATCCTCTGCCCTGG + Exonic
934932252 2:98436144-98436166 CCAACATGTGATGTCTCCCCCGG + Intergenic
937794720 2:126003178-126003200 CCAACATGTGATGTCTCCCCCGG + Intergenic
938858608 2:135342131-135342153 CCAACATGTGATGTCTCCCCCGG + Intronic
940156466 2:150661989-150662011 CCAACATGTGATGTCTCCCCTGG - Intergenic
941184036 2:162298891-162298913 CCACCTTGCATATTCTCTCCTGG + Intronic
941202229 2:162526090-162526112 CCAACATGTGATGTCTCCCCTGG - Intronic
945066621 2:205953065-205953087 CCAACATGTGATGTCTCCCCTGG - Intergenic
945095669 2:206216567-206216589 CCACCATGCCTGGTCTCAACAGG + Intronic
948012905 2:234664289-234664311 CCAACATGTGATGTCTCCCCCGG + Intergenic
948297672 2:236875051-236875073 CCACCATGCACTTTTGCCCCAGG + Intergenic
948912718 2:241012398-241012420 CCACCCTGCATCGCCACCCCAGG + Intronic
1169340073 20:4789946-4789968 CCACCATGTATTGCCTCCGGGGG + Intronic
1172716472 20:36968106-36968128 CCGCCGTGCATTGTGTCCCTGGG - Intergenic
1174059640 20:47823623-47823645 CCACCATCTCTTGTCTCTCCTGG + Intergenic
1175423425 20:58850316-58850338 CCTCCATGCATGTGCTCCCCTGG + Intronic
1176262570 20:64190142-64190164 TCACCTTGCAGTGTCTGCCCAGG - Exonic
1176596870 21:8705668-8705690 CCACCCTGCCTTCTCTCCCACGG - Intergenic
1180279790 22:10683110-10683132 CCACCCTGCCTTCTCTCCCACGG - Intergenic
1180587008 22:16901636-16901658 CCACCCTGCCTTCTCTCCCACGG - Intergenic
1181316714 22:21975267-21975289 GCCCCAGGCATTGTCACCCCTGG - Intronic
1181601224 22:23952958-23952980 ACCCCATGCATTGTCCCACCTGG - Intergenic
1181607288 22:23988376-23988398 ACCCCATGCATTGTCCCACCTGG + Intergenic
1182109362 22:27711842-27711864 CCACCGTGCCTGGCCTCCCCAGG + Intergenic
1183625373 22:38998190-38998212 CCAACATGTGATGTCTCCCCCGG - Intergenic
1184240964 22:43211087-43211109 CCACACTGCCTTGTGTCCCCCGG - Intronic
1185082936 22:48719578-48719600 CCCCCCTGCATTCTCTCCCAAGG + Intronic
949485429 3:4533292-4533314 CCACGCTGTAGTGTCTCCCCAGG - Intronic
949522840 3:4872430-4872452 CCACCACGCCTGGCCTCCCCAGG - Intronic
949638943 3:6013799-6013821 CCAACATGTGATGTCTCCCCCGG + Intergenic
953519648 3:43629095-43629117 CCAACATGTGATGTCTCCCCCGG + Intronic
953709690 3:45259710-45259732 CTCACATGCATTATCTCCCCAGG + Intergenic
953994069 3:47506076-47506098 CCAACATGTGATGTCTCCCCCGG - Intronic
956171244 3:66435269-66435291 CCACCATGCCTAGCCCCCCCTGG - Intronic
958684250 3:97372196-97372218 CCAACATGTGATGTCTCCCCCGG + Intronic
959948595 3:112152704-112152726 CCACAGTGCATTGTGTCCCTGGG + Intronic
960004050 3:112763914-112763936 CCACCATGCCTGGTCGCCACTGG - Intronic
960374210 3:116878543-116878565 CCAACATGTGATGTCTCCCCAGG - Intronic
961300837 3:125921053-125921075 CCGCCCTGCACTGTCTCCCATGG - Intergenic
961649219 3:128409094-128409116 CCACCCTGCCTTGTAGCCCCAGG + Intergenic
961698204 3:128721297-128721319 CCAACATGTGATGTCTCCCCCGG + Intergenic
962962025 3:140320084-140320106 CCACCATGCATTGTGGCTTCTGG + Intronic
963500111 3:146115068-146115090 CCAACATGTGATGTCTCCCCCGG + Intronic
963518532 3:146337140-146337162 CCACCATACATCGTCTCTGCTGG - Intergenic
965110717 3:164418072-164418094 TCACCATGCATCTTCTCCTCTGG - Intergenic
965857025 3:173101857-173101879 CCACTATGCATTCTCTTCACTGG + Intronic
965928880 3:174017641-174017663 CCAACATGTGATGTCTCCCCCGG - Intronic
968207577 3:196817638-196817660 CCACCATGCCTGGCCTCCCCTGG + Intronic
968224111 3:196962314-196962336 CCACAGTGCATTGTGTCCCTGGG - Intronic
968425297 4:519281-519303 TCGCCATGCTGTGTCTCCCCTGG + Intronic
968627613 4:1634248-1634270 CCACCCTGCCCTGTCTCCACTGG - Intronic
968730591 4:2267621-2267643 CCTCCCTGCATTCTCGCCCCAGG + Intergenic
968996804 4:3950969-3950991 CCGCCCTGCACTGTCTCCCATGG + Intergenic
969757204 4:9157707-9157729 CCGCCCTGCACTGTCTCCCATGG - Intergenic
973585925 4:52391000-52391022 CCAACATGTGATGTCTCCCCTGG + Intergenic
973798240 4:54450560-54450582 CCAACATGTGATGTCTCCCCCGG + Intergenic
974014287 4:56634781-56634803 CCACCATCCACTTTGTCCCCTGG + Intergenic
974844754 4:67338692-67338714 CCTCCAGGCATTGTCTTCACAGG - Intergenic
975954773 4:79824519-79824541 CCAACATGTGATGTCTCCCCTGG - Intergenic
976375363 4:84339673-84339695 CCAACATGTGATGTCTCCCCCGG - Intergenic
978069854 4:104453858-104453880 CCAACATGGATTTTGTCCCCAGG + Intergenic
978522541 4:109631723-109631745 CCACCATGCATTGTCTCCCCAGG - Intronic
979016508 4:115441374-115441396 CCAACATGCAATGTCTCCCCCGG - Intergenic
979147571 4:117264555-117264577 CCAACATGTGATGTCTCCCCCGG - Intergenic
979195948 4:117920095-117920117 CCAACATGTGCTGTCTCCCCCGG + Intergenic
980629558 4:135414554-135414576 CCACCCTGCCTTCTCTTCCCCGG + Intergenic
981022036 4:140039402-140039424 CCACCATGCATGGTCAGCCATGG - Intronic
983985395 4:174053606-174053628 CCACCATGCCCTGTCTACCCTGG - Intergenic
985071442 4:186170203-186170225 CCACCAGGCATGGCCTCCTCCGG - Intronic
986869668 5:12031520-12031542 CCTCCATGCATAGTCCCCACTGG + Intergenic
988245466 5:28675084-28675106 CCAACATGTGATGTCTCCCCTGG - Intergenic
988720163 5:33869537-33869559 CCAACATGTGATGTCTCCCCTGG - Intronic
989513874 5:42319435-42319457 CCAACATGTGATGTCTCCCCTGG - Intergenic
989586477 5:43077712-43077734 CCACAGTGCATTGTGTCCCTGGG + Intronic
989624399 5:43415553-43415575 CCAACATGTGATGTCTCCCCTGG + Intergenic
992224959 5:74611252-74611274 CCACCATGCGATGTATCCCTGGG + Intergenic
993412547 5:87591544-87591566 CCACCCTGCCTTCTCTCGCCCGG - Intergenic
997651602 5:135525818-135525840 TCAACATGCCCTGTCTCCCCTGG + Intergenic
998777182 5:145616533-145616555 CCAACATGTGATGTCTCCCCTGG - Intronic
1000004490 5:157170479-157170501 CCAACATGTGATGTCTCCCCCGG + Intronic
1003336705 6:5180244-5180266 CCACCATACATGGTAGCCCCGGG - Intronic
1004267183 6:14158930-14158952 CCGTCATGTGTTGTCTCCCCTGG - Intergenic
1005525285 6:26641762-26641784 CCACAGTGCATTGTGTCCCTGGG - Intronic
1005819007 6:29581472-29581494 CAACCAAGCATTCTCTACCCTGG + Intronic
1005971399 6:30764659-30764681 CCAACATGTGATGTCTCCCCCGG - Intergenic
1005984108 6:30859840-30859862 CCCCCATGCAGGGTCTCCACTGG - Intergenic
1006289363 6:33122637-33122659 CCACAGTGCATTGTGTCCCTGGG + Intergenic
1006815136 6:36844996-36845018 CCACTATTCATTGTAGCCCCGGG + Intergenic
1009544201 6:65003632-65003654 CCAACATGGGATGTCTCCCCCGG + Intronic
1010236161 6:73576512-73576534 CCAACATGTGATGTCTCCCCCGG + Intergenic
1011066131 6:83327842-83327864 CCAACATGTGATGTCTCCCCCGG + Intronic
1011959843 6:93073849-93073871 CCAACATGTGATGTCTCCCCTGG + Intergenic
1012960302 6:105615199-105615221 CCGACATGTGTTGTCTCCCCTGG - Intergenic
1013865185 6:114688422-114688444 CCAACATGTGATGTCTCCCCCGG - Intergenic
1014290708 6:119554472-119554494 CCAACATGTGATGTCTCCCCTGG + Intergenic
1015276572 6:131388572-131388594 TCACCATCCATTTTCTTCCCTGG + Intergenic
1018059799 6:160081288-160081310 CCAACATGTAATGTCTCCCCCGG - Intronic
1020237494 7:6367620-6367642 CCTCCATGCATTGTCATCACAGG + Intergenic
1020321090 7:6939353-6939375 CCATCCTGCATTGTCTCCCATGG + Intergenic
1020387709 7:7626116-7626138 CCAACATGTGATGTCTCCCCTGG - Intergenic
1021139233 7:17003495-17003517 CCAACATGCGATGTCTTCCCCGG - Intergenic
1024049101 7:45607244-45607266 CCACCATAAAGTGTCTACCCTGG - Intronic
1024715911 7:52078878-52078900 CCACAAAGCATTGCCTTCCCAGG + Intergenic
1024970686 7:55067004-55067026 CCACCATGCAGTGGCTGGCCAGG + Intronic
1025235266 7:57230365-57230387 CCACCATCTCTTGTCTCTCCTGG - Intergenic
1025243342 7:57296611-57296633 CCACCATGCCTGGCCTCGCCCGG - Intergenic
1027793193 7:82658582-82658604 CCGACATGTAATGTCTCCCCTGG - Intergenic
1028435087 7:90794069-90794091 CCAACATGTGATGTCTCCCCCGG - Intronic
1028892034 7:95999193-95999215 CCACCCTGCATTGCTTACCCTGG + Intronic
1029922769 7:104283270-104283292 CCACCAGGCTGTGTTTCCCCTGG + Intergenic
1031026682 7:116686811-116686833 CAACCCTGCATCTTCTCCCCAGG + Intronic
1032079133 7:128849954-128849976 CCCCCGTGCCTTGCCTCCCCAGG + Exonic
1032085643 7:128882081-128882103 TCCCCATGCACTGTGTCCCCAGG + Intronic
1032898415 7:136278723-136278745 CTACCATGCATTGCCTCCAAAGG + Intergenic
1033324674 7:140367771-140367793 CCACCGTGGAATGTCTCCCAGGG + Intronic
1034425199 7:151010361-151010383 CCCCCATGCAAAGTCCCCCCTGG + Intronic
1034609453 7:152352528-152352550 CCAACATGTGATGTCTCCCCCGG + Intronic
1036380437 8:8233022-8233044 CCACCCTGCACTGTCTCCCATGG - Intergenic
1036734610 8:11300016-11300038 CCCCCAGGCATTGTCTACTCTGG + Exonic
1036849128 8:12189638-12189660 CCACCCTGCACTGTCTCCCATGG + Intronic
1036870489 8:12431912-12431934 CCACCCTGCACTGTCTCCCATGG + Intronic
1037907061 8:22721730-22721752 CCTCCACGGATTCTCTCCCCTGG + Intronic
1041664871 8:60433608-60433630 CCAACATGTGATGTCTCCCCTGG - Intergenic
1043372748 8:79612646-79612668 CCACCCTGCCTTTTCACCCCGGG - Intronic
1043684742 8:83071354-83071376 CCAACATGTGATGTCTCCCCCGG - Intergenic
1044170399 8:89043935-89043957 CCAACATGTGATGTCTCCCCCGG + Intergenic
1045798758 8:106077652-106077674 CCAACATGTGATGTCTCCCCCGG + Intergenic
1046238715 8:111462761-111462783 CCACCATGCCTGGTCTACCCTGG + Intergenic
1048283505 8:133123121-133123143 CCAGCAAGGATTGTGTCCCCAGG - Intronic
1049026866 8:139997585-139997607 GTAGGATGCATTGTCTCCCCTGG - Intronic
1049965763 9:777745-777767 CCACCATGCCTGGTCTCACTGGG - Intergenic
1050938181 9:11424882-11424904 CCCCCATGCAGAGTCTCCACTGG - Intergenic
1051833839 9:21311774-21311796 CCAACATGTGATGTCTCCCCGGG + Intergenic
1053695927 9:40639240-40639262 CCACCCTGCCTTCTCTCCCATGG - Intergenic
1053942912 9:43270278-43270300 CCACCCTGCCTTCTCTCCCACGG - Intergenic
1054307174 9:63438458-63438480 CCACCCTGCCTTCTCTCCCATGG - Intergenic
1054405907 9:64762450-64762472 CCACCCTGCCTTCTCTCCCATGG - Intergenic
1054439533 9:65247937-65247959 CCACCCTGCCTTCTCTCCCATGG - Intergenic
1054490874 9:65774002-65774024 CCACCCTGCCTTCTCTCCCATGG + Intergenic
1055159688 9:73110544-73110566 CCACAATGCTTTGAGTCCCCAGG + Intergenic
1057370866 9:94471885-94471907 CCAACATGTGATGTCTCCCCTGG - Intergenic
1058268478 9:102937564-102937586 CCAACATGTGATGTCTCCCCTGG + Intergenic
1058288756 9:103211347-103211369 CCAACATGTGATGTCTCCCCTGG - Intergenic
1060603875 9:124896993-124897015 CCACCAGCCATGCTCTCCCCTGG + Intronic
1060671014 9:125469569-125469591 CATCTCTGCATTGTCTCCCCTGG - Intronic
1061486945 9:130924830-130924852 TCACCACGCCTCGTCTCCCCTGG + Intronic
1061530958 9:131212462-131212484 CCAACATGTGATGTCTCCCCTGG + Intronic
1062284282 9:135766194-135766216 CCACCCTGGATGGTCCCCCCTGG - Intronic
1202778374 9_KI270717v1_random:12853-12875 CCACCCTGCCTTCTCTCCCATGG - Intergenic
1203573317 Un_KI270744v1:152940-152962 CCACAGTGCATTGTGTCCCTGGG - Intergenic
1185995527 X:4944292-4944314 CCACCATGCCTGGCCTTCCCTGG - Intergenic
1186132118 X:6479046-6479068 CCAACATGTGATGTCTCCCCCGG + Intergenic
1186329194 X:8514162-8514184 CCAACATGTGATGTCTCCCCCGG + Intergenic
1186872928 X:13790139-13790161 CCACCATGCCTGGTCTGCCAGGG + Intronic
1188446180 X:30255526-30255548 CCAACATGTGATGTCTCCCCCGG - Intergenic
1188537469 X:31213521-31213543 CCACGATGCATTTTCTCTCTTGG - Intronic
1189142909 X:38625449-38625471 CCTCCAAGCCTTGCCTCCCCAGG + Intronic
1189219268 X:39357266-39357288 CTCTCATGCATAGTCTCCCCTGG + Intergenic
1189978934 X:46489803-46489825 CCAACATGTGATGTCTCCCCCGG - Intronic
1190167755 X:48087306-48087328 CCACCATGCTCAGCCTCCCCAGG - Intergenic
1190914598 X:54801696-54801718 CTTCCCTGCTTTGTCTCCCCAGG - Intergenic
1192239229 X:69316099-69316121 CCACCATCTTTTCTCTCCCCAGG + Intergenic
1193637374 X:83969024-83969046 CAACCATTCACTGTCTCCCTTGG - Intergenic
1193994199 X:88344719-88344741 CCAACATGTGATGTCTCCCCCGG - Intergenic
1195838368 X:109144594-109144616 CCAACATGTGATGTCTCCCCTGG + Intergenic
1197086545 X:122483154-122483176 CCAACATGTGATGTCTCCCCCGG + Intergenic
1197487889 X:127075698-127075720 CCACCAATCATTGTCCCCCACGG - Intergenic
1198775683 X:140176664-140176686 CTTCCACCCATTGTCTCCCCAGG - Intergenic
1200046558 X:153406002-153406024 CCACCAGGCAATGCCTCCCTGGG - Intergenic
1200878333 Y:8183775-8183797 CCAACATGTGATGTCTCCCCTGG - Intergenic
1201193687 Y:11471157-11471179 CCACCCTGCCTTCTCTCCCACGG - Intergenic