ID: 978523115

View in Genome Browser
Species Human (GRCh38)
Location 4:109636927-109636949
Sequence TCTAGAGACCAGTAGTCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978523115 Original CRISPR TCTAGAGACCAGTAGTCCAG TGG Intronic
908467028 1:64406453-64406475 TCAAGAAACCAATAGTCTAGTGG + Intergenic
912645962 1:111391887-111391909 CCTAGAGACCAAAAGTGCAGGGG - Intergenic
917863368 1:179170078-179170100 TCTAGAGACTAGGAGTCCAAGGG + Intronic
918889424 1:190246275-190246297 TCTAGAGACCAGAATCCCAGAGG + Intronic
1062938726 10:1406510-1406532 TCTAGCGACCAGTGGTCCCCAGG - Intronic
1063273778 10:4541316-4541338 ACTAGAGACCAGCACTGCAGAGG - Intergenic
1064250120 10:13700466-13700488 GCTAGAAACCACTAGCCCAGGGG + Intronic
1067576753 10:47413972-47413994 TCTAGAGGGCAGGAGGCCAGGGG + Intergenic
1076111959 10:127866805-127866827 TGTAGAGTCCAATAGTCCAATGG + Intergenic
1076248720 10:128967627-128967649 TCCAGAGTCCAGTAGACCAAAGG + Intergenic
1076265668 10:129108015-129108037 ACTATAGACAATTAGTCCAGGGG - Intergenic
1077047803 11:554052-554074 TCGACAGACCTGCAGTCCAGGGG + Exonic
1078077020 11:8171476-8171498 TCTATAGTCCAGGAGTCCAGAGG - Intergenic
1078568888 11:12440529-12440551 TCTATAGGTCAGAAGTCCAGCGG + Intronic
1079175033 11:18132162-18132184 TCTAGAGTCCCATTGTCCAGAGG - Intronic
1081546947 11:44078311-44078333 AGCAGAGACCAGTATTCCAGTGG + Intronic
1084111202 11:67015227-67015249 AGTAGAGACCAGTAGTCCCTGGG + Intronic
1084116393 11:67045218-67045240 TCTAGAGAACTGAAGACCAGGGG + Intronic
1086759421 11:90609056-90609078 TCTAGATGCCAGTAGTCCAGTGG + Intergenic
1089312789 11:117571124-117571146 TCGGGAGACCAGTGCTCCAGAGG + Intronic
1089772734 11:120815193-120815215 CCTGGAGCCCAGTCGTCCAGGGG + Intronic
1090110458 11:123902068-123902090 TATAAAGACCAGTAGTCCCAAGG - Intergenic
1093851017 12:24038346-24038368 TCTAGAAACCAGGAGTAAAGAGG + Intergenic
1094275105 12:28666056-28666078 TCTAGAGACCAGCAGAAAAGAGG + Intergenic
1095182425 12:39161185-39161207 TCTAGAAACTCATAGTCCAGTGG - Intergenic
1095736152 12:45558660-45558682 TCTGAAGACAAGCAGTCCAGTGG - Intergenic
1102442082 12:112971179-112971201 TATTGAAACCAATAGTCCAGTGG - Exonic
1105408223 13:20149273-20149295 TCTTGAGCCCAGGAGTTCAGGGG + Intronic
1111317079 13:86577441-86577463 TATATACACCACTAGTCCAGAGG + Intergenic
1111602563 13:90493747-90493769 CCCAGAGACTAGTAGTCTAGGGG + Intergenic
1119860729 14:77934087-77934109 TCTAGGGAACAGAAGGCCAGGGG + Intronic
1122615330 14:103013784-103013806 TCTGGAGGCCAGAAGTCCAGAGG - Intronic
1123122385 14:105922855-105922877 TCTAGGGCCCAGTGGGCCAGGGG + Intronic
1127671430 15:61198808-61198830 TCCAGAGCCCAGTAATCAAGAGG + Intronic
1128968529 15:72086031-72086053 TGTAGTGACAAGTAGTCCAGGGG - Intronic
1129156056 15:73718862-73718884 TCCAGATCCCATTAGTCCAGCGG + Intergenic
1129170150 15:73802579-73802601 TCCAGAGACAAGTAATCAAGTGG - Intergenic
1130987668 15:88855271-88855293 TCTGGAGACCTGGACTCCAGTGG + Exonic
1131852350 15:96556619-96556641 TCCAGAGACAGGTAGTCCTGAGG + Intergenic
1133823395 16:9256756-9256778 CCAAGACACCACTAGTCCAGAGG - Intergenic
1140328991 16:74034455-74034477 AATAGAGGCCAGTAGTCCAGAGG - Intergenic
1141658447 16:85428760-85428782 TCTAGTTACCAGGGGTCCAGTGG + Intergenic
1142758928 17:2031893-2031915 CTTAGAGACCAGCAGTCTAGTGG - Intronic
1143994574 17:10995598-10995620 TCTAGAGCCCAGTAGCACAGTGG + Intergenic
1146511617 17:33454279-33454301 TGTGGTGACCAGTAGTACAGTGG + Intronic
1148001409 17:44389614-44389636 TCTAGCCACCATGAGTCCAGGGG - Intergenic
1148453584 17:47797935-47797957 CCTTGAGACCAGAAGTCAAGAGG + Intergenic
1150840075 17:68599868-68599890 TCTGGAAACCCGAAGTCCAGCGG + Intronic
1154071453 18:11155931-11155953 TCTAGAGAACCGTAATACAGGGG - Intergenic
1155794565 18:30019689-30019711 TCTAGAAGACAGTAGACCAGAGG + Intergenic
1156693258 18:39734479-39734501 GCTACAGACCAGGAGTTCAGAGG + Intergenic
1157968648 18:52239497-52239519 TCTTGTGTCTAGTAGTCCAGAGG - Intergenic
1160128746 18:76205090-76205112 TCTATAGCCCAGTTGTCCATAGG - Intergenic
1160423043 18:78761845-78761867 TCTAGAGACACATAGTCCAGTGG - Intergenic
1161342680 19:3751643-3751665 ACCAGAGACCTGGAGTCCAGGGG + Intronic
1162636105 19:11968715-11968737 TATAGAGATCAGTAGTAGAGAGG + Intronic
1164538653 19:29105959-29105981 GCTAGGAACCAGGAGTCCAGGGG - Intergenic
1165986268 19:39771520-39771542 TCTAAAGAACAGTGGTCCATGGG - Intergenic
929902927 2:46021419-46021441 TCAATAGGCCAGGAGTCCAGAGG + Intronic
934685899 2:96321521-96321543 TCTAGGGACCGGTAGCTCAGAGG + Intergenic
936854757 2:116943630-116943652 TTGAGAGACCAGTATCCCAGAGG + Intergenic
937124087 2:119462174-119462196 TCTAGAGAGTAGGAGTCCACAGG + Intronic
941956755 2:171213152-171213174 TATAGAGCCCTGTAGTCTAGCGG - Intronic
942634595 2:177989712-177989734 TCTAAATACCAGGAGTCCACTGG + Intronic
947973479 2:234344227-234344249 CCCAGAGAGCAGCAGTCCAGAGG - Intergenic
948130993 2:235600462-235600484 TCTAGAGAACCCTAATCCAGCGG - Intronic
948870987 2:240797976-240797998 TCTAGAAAGCAGGAGCCCAGCGG + Intronic
1173351674 20:42251239-42251261 TCTAGAGACTAGGAGTGCAATGG + Intronic
1175600682 20:60270279-60270301 TCTAGAGTCCAGGATCCCAGAGG - Intergenic
1177726003 21:24968863-24968885 TCTGGAGCTCAGTAGCCCAGTGG - Intergenic
1180734488 22:18005716-18005738 TCTAGCCACCAGCACTCCAGCGG - Intronic
1184230949 22:43158174-43158196 ACGAGAGACAAGCAGTCCAGGGG - Intronic
1184539064 22:45107720-45107742 TCCTGAGAGCAGTTGTCCAGGGG - Intergenic
1185228070 22:49664423-49664445 TCTAGAGACCAGTTGGCCAACGG + Intergenic
955042741 3:55333046-55333068 TCCTGAGACCTGGAGTCCAGGGG - Intergenic
955155575 3:56413548-56413570 CTTAGAGACCAGTAGTCAAATGG - Intronic
955589261 3:60516491-60516513 TCTCTAGACCAGTGGTCCTGGGG - Intronic
956763540 3:72464514-72464536 TCTAAAGGCCAGTAGTGCTGAGG + Intergenic
958164445 3:89861673-89861695 TCAAGGGACCAGAAGACCAGAGG - Intergenic
960334488 3:116399758-116399780 GCTACTGACCAGCAGTCCAGAGG + Intronic
965437406 3:168669685-168669707 TCCAAAGACCATTAGGCCAGAGG + Intergenic
966459805 3:180164363-180164385 TCTAGATACAAGAAATCCAGAGG - Intergenic
967868630 3:194211245-194211267 TCAGGAGTCCAGGAGTCCAGTGG - Intergenic
969146459 4:5128188-5128210 TCTGGAGGCCAGAAGTCCAAAGG - Intronic
970938924 4:21608225-21608247 TCTATAGGTCAGAAGTCCAGTGG + Intronic
975888553 4:78995816-78995838 ACTAGAAACCAGTAGACAAGGGG - Intergenic
978482019 4:109203549-109203571 GCCAGAGACCACCAGTCCAGAGG + Intronic
978523115 4:109636927-109636949 TCTAGAGACCAGTAGTCCAGTGG + Intronic
979290662 4:118976318-118976340 TCTTGAGACCACGAGCCCAGCGG - Intronic
981873886 4:149517988-149518010 TCTAGAGACCCCTAATACAGAGG + Intergenic
983465531 4:168083538-168083560 TCTAGAAACAAGTAGGCCACAGG + Intergenic
986348332 5:6854644-6854666 TCTAGAGCCCAGAAGTCCAAAGG - Intergenic
988445825 5:31284788-31284810 TCTAGAGACCAGAGGATCAGAGG + Intronic
990443102 5:55866290-55866312 GCTAGGGACCACTAGTCTAGGGG - Intronic
991678460 5:69112716-69112738 TCTAGAGAAAAATAATCCAGAGG - Intronic
991686446 5:69186679-69186701 ACTAGAGACCAGCACTTCAGAGG - Intergenic
993447231 5:88028177-88028199 TCTACATTCCAGTAGTACAGAGG - Intergenic
999120619 5:149206821-149206843 TCAAGAGGCCAGGACTCCAGTGG + Intronic
1000883641 5:166725707-166725729 TCTAGAGAACATGATTCCAGTGG - Intergenic
1005772165 6:29084827-29084849 ACAAGACAGCAGTAGTCCAGAGG - Intergenic
1005864618 6:29928195-29928217 TCTAGAGACCAGGCCTGCAGGGG + Intergenic
1007753333 6:44083157-44083179 TCTAGAGCCCAGCAGGCCTGAGG - Intergenic
1013655739 6:112244482-112244504 TCTATAGACAAGCAGTCCTGAGG - Intronic
1015246931 6:131085346-131085368 TGTAGTGACCAGTGGTTCAGAGG + Intergenic
1018831156 6:167444567-167444589 TCTATAGACCAGAGGTCCATGGG - Intergenic
1019043298 6:169123774-169123796 TGTAGAGAAGGGTAGTCCAGTGG - Intergenic
1020223536 7:6261099-6261121 TCTGGAGGCCAGGATTCCAGAGG + Intronic
1021342849 7:19486726-19486748 TCTGTAGATCAGAAGTCCAGAGG + Intergenic
1023257282 7:38324325-38324347 TCTATAGACCTTTAGCCCAGGGG + Intergenic
1024749468 7:52448323-52448345 TCTAAAGACATCTAGTCCAGTGG - Intergenic
1028046627 7:86128718-86128740 TCTAGAGATCTGTTGTGCAGTGG - Intergenic
1028482230 7:91320017-91320039 TCTAGAGAACAGTATTTAAGAGG + Intergenic
1028511003 7:91626324-91626346 TCAAGAGGCGAGCAGTCCAGAGG + Intergenic
1030389188 7:108904519-108904541 TTTAGAAACAAGTAATCCAGTGG - Intergenic
1035113600 7:156505024-156505046 CTTAGAGACCAGGTGTCCAGAGG - Intergenic
1036960196 8:13237123-13237145 TCTAAGGACCAGTAATGCAGTGG + Intronic
1038240983 8:25807812-25807834 TCTAGCAAGCAGTAGGCCAGTGG - Intergenic
1038742773 8:30230488-30230510 TGCAGAGACCTGTAGTCCTGTGG + Intergenic
1040668620 8:49659428-49659450 TGAAGTGACCAGCAGTCCAGGGG + Intergenic
1042189061 8:66167138-66167160 CATAGAGACCAGAAGTCCAAAGG - Intronic
1042386960 8:68187873-68187895 TCCAGAGTCCAGCAGGCCAGAGG - Intronic
1048987313 8:139741444-139741466 TCCAGAGCCCAGGAATCCAGTGG - Intronic
1049317440 8:141976857-141976879 TTCAGAGACCAGAAGTGCAGTGG - Intergenic
1052493622 9:29198147-29198169 TCTACAGACCATTGTTCCAGAGG - Intergenic
1055361876 9:75500343-75500365 TCTAGAGACTGGAAGTCCAAGGG + Intergenic
1056120071 9:83478951-83478973 TCTAGGGACCCGTAGTGCATAGG - Intronic
1057141994 9:92732157-92732179 TCTAGAGACGAAAAGTACAGTGG + Intronic
1059435672 9:114274687-114274709 GATGGAGACCAGCAGTCCAGTGG + Intronic
1185782610 X:2862291-2862313 TCTGGGGGCCAGAAGTCCAGTGG - Intronic
1189138680 X:38577908-38577930 TCTAGTGACCAGGAGTTCACTGG - Intronic
1190594305 X:52037704-52037726 TCCAGAGACCAGCAGCCAAGTGG + Intergenic
1192541249 X:71975094-71975116 TCTCCAGCCCAGTAGTCCTGCGG - Intergenic
1193894658 X:87098486-87098508 TGTTGTGACCAGTGGTCCAGGGG - Intergenic
1194015386 X:88613127-88613149 TGTAGAGACCATTAGTCCTAAGG - Intergenic
1196142042 X:112274149-112274171 TATATAGAGCAGTAGTCAAGAGG - Intergenic
1199513219 X:148646539-148646561 TGTAGACATCAATAGTCCAGAGG - Intronic