ID: 978523154

View in Genome Browser
Species Human (GRCh38)
Location 4:109637263-109637285
Sequence CAGTGTAACCATAAGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 109}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978523145_978523154 29 Left 978523145 4:109637211-109637233 CCAAGCTGTGGGGAAATGTGTCA 0: 1
1: 0
2: 1
3: 8
4: 178
Right 978523154 4:109637263-109637285 CAGTGTAACCATAAGGGAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 109
978523144_978523154 30 Left 978523144 4:109637210-109637232 CCCAAGCTGTGGGGAAATGTGTC 0: 1
1: 0
2: 1
3: 8
4: 165
Right 978523154 4:109637263-109637285 CAGTGTAACCATAAGGGAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 109
978523149_978523154 5 Left 978523149 4:109637235-109637257 CCCTATGGGGACACAGAAAGACT 0: 1
1: 0
2: 4
3: 33
4: 381
Right 978523154 4:109637263-109637285 CAGTGTAACCATAAGGGAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 109
978523150_978523154 4 Left 978523150 4:109637236-109637258 CCTATGGGGACACAGAAAGACTT 0: 1
1: 0
2: 0
3: 18
4: 199
Right 978523154 4:109637263-109637285 CAGTGTAACCATAAGGGAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978523154 Original CRISPR CAGTGTAACCATAAGGGAGC AGG Intronic
900982841 1:6056427-6056449 CTGTGTAAGCATGAGGGAGCAGG + Intronic
902747935 1:18485490-18485512 CAATGGAACCATAAGAGAGGTGG - Exonic
907087962 1:51695459-51695481 CAGTGGAACCATGAGGTAGTTGG + Intronic
910092331 1:83479938-83479960 GAGAGTAAACATGAGGGAGCAGG - Intergenic
910110967 1:83683072-83683094 CAGAGAAAGCATAAAGGAGCTGG + Intergenic
1063003516 10:1946531-1946553 CAGCCTAACCCGAAGGGAGCTGG + Intergenic
1063494465 10:6494209-6494231 CAGTTTAACCGGAAGGGAGTAGG - Intronic
1065797961 10:29324300-29324322 CAGTGTAACAAGAAGGGAACTGG + Intergenic
1074855441 10:117469708-117469730 CAGTGAAGCCAGGAGGGAGCAGG - Intergenic
1077842838 11:5993840-5993862 CAGAGTACCCTTTAGGGAGCAGG - Intergenic
1079998199 11:27318965-27318987 CAGTGTAAGAATAATGGAGAAGG - Intergenic
1081470020 11:43361024-43361046 CAGTGTAACAATAAGAGGCCAGG + Intronic
1081568324 11:44274191-44274213 CAGTGTAACAAAAGGTGAGCTGG + Intronic
1083013032 11:59422287-59422309 CAATGTAACCATAAGAGATGAGG + Exonic
1085264595 11:75229774-75229796 CAGTGTAACCATCTGGGAATTGG + Intergenic
1086510937 11:87557107-87557129 CATTGTCTCCAAAAGGGAGCTGG - Intergenic
1088261284 11:107946282-107946304 CATTGCAACCATAAAGGAACAGG + Intronic
1088907593 11:114166242-114166264 GTGTGTAACCATGAGGGAGAGGG + Intronic
1089428276 11:118399422-118399444 CAGTGAAGCCAAAAGAGAGCTGG - Intronic
1092803216 12:12192577-12192599 GACAGTAACCATAAGAGAGCTGG + Intronic
1092977314 12:13757924-13757946 AAGTGGATCCATAAGGGATCTGG - Intronic
1096193947 12:49636917-49636939 CAGCGTATCCAGAAGGGGGCAGG - Exonic
1096549479 12:52362762-52362784 CAGTGTGCCCATGAGGAAGCAGG - Intronic
1106317839 13:28610797-28610819 CATTGAAAGCATAAGGGAGGGGG - Intergenic
1106744554 13:32686149-32686171 CACTGTAATCAAAAGGAAGCTGG - Intronic
1116863001 14:50009254-50009276 CAGTGTGACCCTAAGGATGCCGG + Intergenic
1119228158 14:72959919-72959941 CAGCCCAACCAGAAGGGAGCCGG - Intergenic
1122668296 14:103349904-103349926 CAGTGGACCCTCAAGGGAGCTGG + Intergenic
1123097652 14:105774027-105774049 CAGTGTAGCCACAGGTGAGCAGG - Intergenic
1125795898 15:42403690-42403712 CAGTGTCACCAGAAGCAAGCAGG - Intronic
1127565126 15:60180327-60180349 CAGTGTAACCATCAGACACCAGG + Intergenic
1129453586 15:75664179-75664201 CAGTGTGAACACAAGGGTGCTGG + Intergenic
1132242899 15:100274485-100274507 AATTGTAACCAAAAGAGAGCAGG - Intronic
1134840721 16:17399433-17399455 CAGTGTAATGAGGAGGGAGCAGG - Intronic
1135558595 16:23457356-23457378 AAGTGTAATCATAAGAAAGCTGG - Intergenic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1137707707 16:50547501-50547523 CAGTGTCCCCAGAAGGGGGCAGG + Intergenic
1140262511 16:73392529-73392551 GAGTTTATCCATAAGGGAGTAGG + Intergenic
1140950119 16:79808837-79808859 CAGAGTCACCATCAGTGAGCTGG - Intergenic
1142328454 16:89433995-89434017 CAGAGTAACCAGCTGGGAGCTGG - Intronic
1143812520 17:9483818-9483840 CAGTGTAGGCACAAGGGACCAGG - Intronic
1145993535 17:29093092-29093114 CAGTGTCCCCATAAGGATGCTGG + Intronic
1147610594 17:41799657-41799679 CAGTGTATGTATTAGGGAGCAGG - Intergenic
1150967796 17:69991361-69991383 CTCTTTAACCATAAAGGAGCAGG - Intergenic
1156741421 18:40334241-40334263 CATAGTAACCAAAAGAGAGCAGG - Intergenic
1157051709 18:44173879-44173901 CAGTGTAATGATAATGGAGTAGG + Intergenic
1158049830 18:53203557-53203579 CAGTGATACCATAAGGGGCCTGG + Intronic
1159859673 18:73632254-73632276 CACAGTAACCATAAGAGACCTGG - Intergenic
1163564046 19:18039135-18039157 CAATGTGGCCCTAAGGGAGCTGG + Intergenic
1165956545 19:39504933-39504955 CAGTGTAGACAGAAGCGAGCAGG + Intronic
1168231427 19:55034768-55034790 CACTGTAAACATAAGGAAACTGG + Intronic
925133857 2:1512870-1512892 CAGTATAATCATAAGGGTGCTGG - Intronic
926808418 2:16734715-16734737 CAGTGTCTCCACAAGGGAACAGG - Intergenic
929640484 2:43573628-43573650 AAGAGTAACCATGAGGTAGCAGG - Intronic
936430272 2:112456638-112456660 CAGTATAACCAAAAGAGAGCTGG + Intergenic
941623189 2:167801920-167801942 CAGTGTAACTCTATGAGAGCTGG - Intergenic
943821403 2:192327211-192327233 CAGGGTAATCCTAAGGGGGCAGG + Intergenic
944077788 2:195751769-195751791 CATTGTCACCATAAGGGGTCTGG + Intronic
944192588 2:197019528-197019550 CTGTGTAACCATGGGAGAGCTGG - Intronic
947996838 2:234534996-234535018 GAGTGAAACCAGAAGGGAGAGGG - Intergenic
1170706205 20:18746747-18746769 CTGTGTATCCATTTGGGAGCTGG - Intronic
1171412212 20:24955268-24955290 CAGTGTTACCATCAGGAAGGAGG - Intronic
1172210971 20:33198298-33198320 CAGTCTCACCATTAAGGAGCTGG - Intergenic
1172974396 20:38895421-38895443 CAGTGTGAACATCATGGAGCTGG + Intronic
1180582185 22:16848621-16848643 AAGAGTAACCAAAAGAGAGCAGG - Intergenic
1181472795 22:23151275-23151297 CAGTGCTGCCATAAGGGATCAGG - Intronic
1184715369 22:46278944-46278966 CTGTGCAACCCTAAGTGAGCAGG - Intronic
949365547 3:3276669-3276691 CAGTGTTATCATAAAGGAGATGG - Intergenic
950549206 3:13655983-13656005 CAGTGTAGCCATGAGGCACCCGG + Intergenic
950950837 3:16996548-16996570 CAGTGGGACCATAAGGGAAATGG + Intronic
954760017 3:52867239-52867261 CAGTGTAACCTTAAAGCAGGAGG + Intronic
956360102 3:68438489-68438511 CAATGCAACCCTAAGTGAGCTGG - Intronic
963264148 3:143222599-143222621 CAAACTAACCGTAAGGGAGCTGG - Intergenic
966155332 3:176910190-176910212 CAGTGTGACCAAGAGGGAGCAGG - Intergenic
971375246 4:26050907-26050929 CAGTGGAAGCATGAGGAAGCTGG - Intergenic
971841962 4:31864242-31864264 CACAGAAACCAAAAGGGAGCAGG + Intergenic
976519263 4:86007208-86007230 CAGTGTAACCATGAGTGTGGTGG - Intergenic
978523154 4:109637263-109637285 CAGTGTAACCATAAGGGAGCAGG + Intronic
982103279 4:151989523-151989545 CTGTGTAACCACAGGGAAGCAGG - Intergenic
983722938 4:170880815-170880837 CAGAGTAACCAAAAAGGAGCGGG - Intergenic
984235257 4:177149582-177149604 AATTGTAACCAAAAGAGAGCAGG + Intergenic
985804800 5:2035009-2035031 CAGTGGAAGCATCTGGGAGCAGG + Intergenic
990162732 5:52960966-52960988 AATAGTAACCATAAGAGAGCTGG + Intergenic
995569399 5:113463405-113463427 TAGGGTAATCATAAGGGAGATGG + Intronic
997175299 5:131769651-131769673 CAATGGAACCATGAGGGACCGGG + Intronic
997365057 5:133320319-133320341 CAGTGAAACCAGCAGGGGGCAGG - Intronic
997673724 5:135696835-135696857 CAGTGCAGCCACAGGGGAGCTGG + Intergenic
999014059 5:148078117-148078139 AAGTTTAACCGTAAGAGAGCAGG + Intronic
999694757 5:154179146-154179168 TAGTGTAACCATGAGGGACGGGG + Intronic
1002095090 5:176825911-176825933 CCGTGTGACCATGAGGGAGCTGG + Intronic
1005997580 6:30940756-30940778 CAGAGGAACCAGAAAGGAGCAGG - Intergenic
1006034451 6:31200670-31200692 GATTGTAAGCATCAGGGAGCAGG - Intronic
1013955526 6:115836243-115836265 CAGTGTAACCATAAGAGTCCTGG + Intergenic
1015314227 6:131799393-131799415 AATGGTAACCATAAGAGAGCTGG + Intergenic
1015451812 6:133378612-133378634 CAGTGTTACTATATGGGAACTGG + Intronic
1023185271 7:37526571-37526593 CAGTGTGACCAAAAGGAATCTGG - Intergenic
1023505260 7:40892989-40893011 AATAGTAACCAAAAGGGAGCAGG + Intergenic
1024185485 7:46944335-46944357 CAGTGGAAACAGAAGTGAGCAGG - Intergenic
1026959480 7:74399239-74399261 CAGTGTAAGAAGAAGGGTGCTGG + Intronic
1039194353 8:35014276-35014298 CAGCTTAATCATAAGGCAGCAGG - Intergenic
1040745991 8:50643230-50643252 CAGTGTCAGCATAAGAAAGCAGG - Intronic
1040982829 8:53262917-53262939 CAGTGCAAGCAAAAGGGACCTGG + Intergenic
1042286770 8:67121765-67121787 CAGTGAAACCATAAGGTACAGGG + Intronic
1043233944 8:77837004-77837026 CAGTGTTACCCCAAGGGACCTGG + Intergenic
1046701671 8:117407778-117407800 CAGTGTCACCATAATGTAGGAGG + Intergenic
1048099530 8:131334854-131334876 CATAGTAACCAAAAGAGAGCAGG + Intergenic
1049962591 9:750846-750868 GAGTGTTGCCATGAGGGAGCTGG + Intergenic
1050362174 9:4840575-4840597 TATTTTAACCATAAGGTAGCAGG + Intronic
1052320632 9:27163715-27163737 CAGTTTATCCATATGGGAGATGG - Intronic
1055819679 9:80246709-80246731 AACAGTAACCACAAGGGAGCAGG - Intergenic
1057402960 9:94740786-94740808 CTGTGTAACCTTAAGCAAGCTGG + Intronic
1058816797 9:108691822-108691844 CAGTGTAGCCACAAGGAAGCAGG + Intergenic
1186527849 X:10265936-10265958 CAGTGCCTCAATAAGGGAGCAGG + Intergenic
1186694501 X:12015818-12015840 CTTTGTAACCATGAGGCAGCAGG + Intergenic
1187600567 X:20824799-20824821 GAGTGTAACTAGGAGGGAGCAGG - Intergenic
1200290354 X:154866070-154866092 AACTGTAACCAAAAGAGAGCAGG + Intronic
1201475142 Y:14373609-14373631 CAGTGAGATCATGAGGGAGCTGG - Intergenic
1201730282 Y:17194500-17194522 GATTGTAACCGAAAGGGAGCTGG + Intergenic
1201955535 Y:19618415-19618437 CAGTGAAACCAGATGGCAGCTGG + Intergenic