ID: 978524177

View in Genome Browser
Species Human (GRCh38)
Location 4:109647842-109647864
Sequence GTGCGGACACACAATTATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978524177_978524182 -4 Left 978524177 4:109647842-109647864 CCCACATAATTGTGTGTCCGCAC 0: 1
1: 0
2: 0
3: 2
4: 49
Right 978524182 4:109647861-109647883 GCACCTGTTGGGACAGTGTAAGG No data
978524177_978524187 16 Left 978524177 4:109647842-109647864 CCCACATAATTGTGTGTCCGCAC 0: 1
1: 0
2: 0
3: 2
4: 49
Right 978524187 4:109647881-109647903 AGGAAGAGGTGCTGGGCAGATGG No data
978524177_978524185 8 Left 978524177 4:109647842-109647864 CCCACATAATTGTGTGTCCGCAC 0: 1
1: 0
2: 0
3: 2
4: 49
Right 978524185 4:109647873-109647895 ACAGTGTAAGGAAGAGGTGCTGG 0: 1
1: 0
2: 2
3: 26
4: 283
978524177_978524184 2 Left 978524177 4:109647842-109647864 CCCACATAATTGTGTGTCCGCAC 0: 1
1: 0
2: 0
3: 2
4: 49
Right 978524184 4:109647867-109647889 GTTGGGACAGTGTAAGGAAGAGG 0: 1
1: 0
2: 1
3: 22
4: 258
978524177_978524186 9 Left 978524177 4:109647842-109647864 CCCACATAATTGTGTGTCCGCAC 0: 1
1: 0
2: 0
3: 2
4: 49
Right 978524186 4:109647874-109647896 CAGTGTAAGGAAGAGGTGCTGGG 0: 1
1: 0
2: 2
3: 24
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978524177 Original CRISPR GTGCGGACACACAATTATGT GGG (reversed) Intronic
904319037 1:29684642-29684664 GGTCTGACACACTATTATGTGGG - Intergenic
904561598 1:31401802-31401824 GATGGGACACAAAATTATGTAGG + Intergenic
914754163 1:150553637-150553659 GTGTGGACAGACAGTTCTGTGGG - Exonic
924262719 1:242248781-242248803 GTGGAGATACACAATTTTGTAGG - Intronic
1066725513 10:38388149-38388171 GTGGAGATACACAATTTTGTAGG + Intergenic
1069189168 10:65466122-65466144 GGGAGGACACACAATCATGTTGG - Intergenic
1076142377 10:128089912-128089934 CTGAGGACACATAAATATGTTGG + Intergenic
1084097726 11:66923044-66923066 AGGCGAACACACAATAATGTGGG + Intronic
1091372301 11:135070964-135070986 GTGAGGACACACACTGCTGTTGG - Intergenic
1092568465 12:9695358-9695380 GTGGCGACACACACTTAGGTAGG - Intronic
1096776354 12:53966724-53966746 GTGCGGAGAAACAAATATATTGG + Intergenic
1102528817 12:113531316-113531338 GTGAGGCCTCACAATTATGGCGG - Intergenic
1104820844 12:131676599-131676621 GTGCGTACACACAGGTATATGGG + Intergenic
1106371995 13:29143718-29143740 CTGATGACACAAAATTATGTAGG + Intronic
1119989480 14:79179693-79179715 CTGCAGACACCAAATTATGTGGG - Intronic
1122379797 14:101294719-101294741 GTGAGGCCCCACAATTATGGTGG + Intergenic
1134421932 16:14101104-14101126 GTGGGTACACATAATTATGTAGG + Intronic
1137566486 16:49536021-49536043 GTGGGGACAAAAAATGATGTCGG - Intronic
1138695188 16:58806547-58806569 GTGAAGACTCACAATTATGGTGG + Intergenic
1156530739 18:37812613-37812635 GGGAGGACTCACAATTATGGTGG - Intergenic
1157086156 18:44582028-44582050 TTCCGGACACACCATTATGCTGG + Intergenic
1157511350 18:48277647-48277669 GTGAGGACACACCAAAATGTGGG + Intronic
1167728156 19:51233299-51233321 GGGCGAACACACAATTGAGTTGG - Intronic
936627561 2:114164546-114164568 GTTGGCACACACAATTATGGAGG - Intergenic
944356519 2:198795677-198795699 GTGAGTACACTCAATAATGTTGG + Intergenic
1174726906 20:52872108-52872130 GTGCGCACACACATATATATAGG - Intergenic
1180979843 22:19873323-19873345 GAGGGGACACACAGTTATGGAGG - Intergenic
959697495 3:109264228-109264250 GAGAGGACATACAATTATGCTGG - Intergenic
963022398 3:140885184-140885206 GGGAGGCCTCACAATTATGTTGG - Intergenic
973174818 4:47192230-47192252 GTGTGGAAACCCAAATATGTTGG + Intronic
976805297 4:89039513-89039535 GTAAGGACAAAGAATTATGTGGG + Intronic
978524177 4:109647842-109647864 GTGCGGACACACAATTATGTGGG - Intronic
979901525 4:126225268-126225290 GAGAGGACACACAATCATGGTGG - Intergenic
988070620 5:26284280-26284302 GGGAGGACACACAATCATGGAGG + Intergenic
997780914 5:136657597-136657619 GGGCAGACAGACAGTTATGTGGG - Intergenic
1008859126 6:56128034-56128056 GGGTGGACACACAATTGTGCTGG + Intronic
1010180680 6:73083387-73083409 GGGTGAACACACAACTATGTGGG + Intronic
1014304981 6:119728427-119728449 TTGGGGACCCACAATTATGGAGG + Intergenic
1023896634 7:44439206-44439228 GTGAGGACACAGGATTCTGTTGG + Intronic
1029218903 7:98972435-98972457 GTGAGGAGACATAATAATGTTGG + Intronic
1035180047 7:157082772-157082794 GTGTGGACACATATATATGTAGG - Intergenic
1041568525 8:59309055-59309077 GTGAGGAAACACAATTACTTTGG + Intergenic
1048191149 8:132290539-132290561 ATCCTGACACAAAATTATGTTGG + Intronic
1050302091 9:4269852-4269874 GTGGGGACACACAACAAGGTGGG + Intronic
1186109375 X:6239752-6239774 GGGAGGCCTCACAATTATGTTGG + Intergenic
1186965847 X:14785474-14785496 ATGCTGATACACAATTAGGTTGG - Intergenic
1189226946 X:39420934-39420956 GTGCGAACACACACTCATGGAGG + Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1199307552 X:146284692-146284714 GTGAGGCCTCACAATTATGGTGG - Intergenic
1200557110 Y:4648053-4648075 GGGAGGCCACACAATTATGGTGG - Intergenic
1201849458 Y:18462008-18462030 GTGAGGAAACACAGTCATGTTGG + Intergenic
1201883860 Y:18858367-18858389 GTGAGGAAACACAGTCATGTTGG - Intergenic