ID: 978529938

View in Genome Browser
Species Human (GRCh38)
Location 4:109703065-109703087
Sequence CCTGCCGCCTTTGTCCTCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 146}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978529938_978529945 -5 Left 978529938 4:109703065-109703087 CCCCGGAGGACAAAGGCGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 146
Right 978529945 4:109703083-109703105 GCAGGGGCACGCCCCGGCGCCGG No data
978529938_978529952 18 Left 978529938 4:109703065-109703087 CCCCGGAGGACAAAGGCGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 146
Right 978529952 4:109703106-109703128 CGTCGCTACTCGGGACCGCCAGG No data
978529938_978529949 8 Left 978529938 4:109703065-109703087 CCCCGGAGGACAAAGGCGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 146
Right 978529949 4:109703096-109703118 CCGGCGCCGGCGTCGCTACTCGG 0: 1
1: 0
2: 0
3: 2
4: 37
978529938_978529954 24 Left 978529938 4:109703065-109703087 CCCCGGAGGACAAAGGCGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 146
Right 978529954 4:109703112-109703134 TACTCGGGACCGCCAGGAGGCGG 0: 1
1: 0
2: 1
3: 5
4: 79
978529938_978529953 21 Left 978529938 4:109703065-109703087 CCCCGGAGGACAAAGGCGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 146
Right 978529953 4:109703109-109703131 CGCTACTCGGGACCGCCAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 60
978529938_978529950 9 Left 978529938 4:109703065-109703087 CCCCGGAGGACAAAGGCGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 146
Right 978529950 4:109703097-109703119 CGGCGCCGGCGTCGCTACTCGGG 0: 1
1: 0
2: 0
3: 2
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978529938 Original CRISPR CCTGCCGCCTTTGTCCTCCG GGG (reversed) Intronic
900518415 1:3094204-3094226 CCAGCCACCTGTCTCCTCCGCGG - Intronic
901087522 1:6620465-6620487 CCTGCAGCTTTTCTCCTCCTTGG - Intronic
901143402 1:7050182-7050204 ACAGCCGCCTGAGTCCTCCGTGG - Intronic
901399176 1:9004489-9004511 GCTGGCGCCTTTGAGCTCCGCGG + Intronic
901470669 1:9454317-9454339 CTTGGCCCCTTTGTCCTCTGGGG - Intergenic
902858805 1:19229459-19229481 TCTGCCTCCTTTGTCTTCCTTGG + Intronic
903348740 1:22704781-22704803 CCTGCAGCCTCTGTGCTCAGAGG + Intergenic
904297147 1:29527301-29527323 CCTGCTGCCCTTCTCCTCCAGGG - Intergenic
905863776 1:41366175-41366197 TCCTCCTCCTTTGTCCTCCGGGG + Intronic
912491123 1:110063380-110063402 CCTGCCTCCCTGCTCCTCCGAGG - Intronic
913986081 1:143567452-143567474 CCTGCCACCTTAGGCCTCAGTGG + Intergenic
915979333 1:160410345-160410367 CCTGCCCCCCTTTTCTTCCGTGG + Intronic
920963451 1:210683642-210683664 CCTGACGCTTTTGTCCTCTCGGG + Exonic
924059066 1:240153131-240153153 GCTGGCTCATTTGTCCTCCGTGG + Intronic
1074880982 10:117658289-117658311 ACTGCAGCCTTTGCCCTCCTGGG - Intergenic
1076490588 10:130858783-130858805 ACTGCCACCTTTCTCCTCCAGGG - Intergenic
1076873310 10:133204076-133204098 CCTGGCGCCGGTGACCTCCGGGG + Intronic
1077243043 11:1521328-1521350 CCTTCCTCCTTTGTCCTTCTGGG - Intergenic
1077268849 11:1665796-1665818 ATGGCCGCCTTTGTCCTCCCTGG - Intergenic
1077271904 11:1685384-1685406 ATGGCCGCCTTTGTCCTCCCTGG + Intergenic
1077337946 11:2013819-2013841 CCTGCCCGCTTTGTCCCCTGGGG + Intergenic
1081237111 11:40659243-40659265 CCTGCCACCTTGGTCCTCTCTGG + Intronic
1082077794 11:47987753-47987775 CCTACAGCCCCTGTCCTCCGAGG - Intronic
1084683936 11:70682721-70682743 CCTGGAGCCCTTGTCCTCCCAGG + Intronic
1085720172 11:78905582-78905604 CCAGCCACATTTTTCCTCCGAGG + Intronic
1089147506 11:116340586-116340608 CCTGCTGACTTTCTCCTCCTTGG - Intergenic
1089374632 11:117985945-117985967 CCTGGCGCCTTTGCCCTCAAGGG + Intergenic
1089775067 11:120830292-120830314 CCAGCTGAGTTTGTCCTCCGAGG + Intronic
1090764352 11:129863972-129863994 CCTGCCCACTTTGTCCTTCTTGG - Intronic
1090861162 11:130653838-130653860 CCTGCAGCTTTTTTCCTCCCGGG + Intergenic
1090975105 11:131673333-131673355 CCAGCCTCCTTTGTCCTCTAAGG - Intronic
1202820930 11_KI270721v1_random:69001-69023 CCTGCCCGCTTTGTCCCCTGGGG + Intergenic
1091765685 12:3118660-3118682 CCTGCAGCCCTTGGCCTCCTTGG + Intronic
1091831073 12:3551543-3551565 CCTGGCGCCTGAGTCATCCGGGG + Intronic
1096007443 12:48184220-48184242 CATGCCGCCGTTGTACTCCCCGG - Exonic
1096137340 12:49213482-49213504 ACTGCAGCCTTTGACCTCCTAGG + Intronic
1096530539 12:52239819-52239841 CCTCTCACCCTTGTCCTCCGGGG + Intronic
1097125497 12:56771253-56771275 CCTTCCCCCTTTGTCCTCTGAGG + Intronic
1100596576 12:96077440-96077462 CCTCCCACCTTTGTTCTCCTGGG + Intergenic
1101936825 12:109064938-109064960 CCTGCTCCCTTTGTCCTGGGAGG + Intronic
1105409703 13:20161304-20161326 CCTGCCGCCTACGCACTCCGGGG + Intergenic
1105502812 13:20988076-20988098 CTTTCCGCCTTTGTCCCCCTTGG + Exonic
1106314240 13:28579262-28579284 CCTGCCACATGTGTCCTCCTGGG + Intergenic
1112599767 13:100843499-100843521 CCTGGCGCATTTGTCTTCCGTGG - Intergenic
1113837380 13:113337216-113337238 ACTGCAGCCTTTGACCTCCTGGG - Intronic
1115209367 14:30949824-30949846 CCTGCTTCCATTGTCCTCAGTGG - Intronic
1124158812 15:27251231-27251253 CCTGCCTCTCTTGTCCTCAGCGG + Intronic
1124183465 15:27500256-27500278 CCTGCTGCCTCTGTCCTACCAGG - Intronic
1126540094 15:49813041-49813063 CCTGCCGCCTCTGTGCTCTCAGG + Intergenic
1127159448 15:56165976-56165998 ACTGCAGCCTTTGACCTCCTGGG + Intronic
1129424766 15:75455186-75455208 GCTGCCGCCCTTGTCCAGCGTGG + Intronic
1129853992 15:78811373-78811395 CCTGCAGCCTTTGTTGCCCGCGG - Exonic
1131564313 15:93472157-93472179 CCTTCCGCTTCTGACCTCCGGGG - Intergenic
1131832257 15:96361357-96361379 CCTCCCCCCTTTCTCCTCTGGGG + Intergenic
1134932109 16:18216528-18216550 CCTGCCTCCCTCCTCCTCCGGGG - Intergenic
1137554288 16:49460950-49460972 GCTGGCGCCTCTGTCCTCCACGG + Intergenic
1137834138 16:51574529-51574551 ACTGCAGCCTTTGACCTCCTGGG + Intergenic
1138391153 16:56670647-56670669 CCTGCTTCCTTTGTCCCCCTAGG + Intronic
1141120890 16:81355212-81355234 CCTGCCTGCTTTCTCCTGCGTGG - Intronic
1141407902 16:83809543-83809565 CCTGCAACCTTTGCCCTCCTGGG + Intronic
1141573367 16:84948160-84948182 CCTGCCACCTCAGTCCCCCGGGG - Intergenic
1141612700 16:85191958-85191980 ACTGCTGCCCTTGTCCTCCTTGG - Intergenic
1141878375 16:86841881-86841903 CCTGCCTCCATTCTCCTCCCTGG + Intergenic
1142076384 16:88120462-88120484 CCAGCTGCCTGTGTTCTCCGAGG - Intergenic
1143914140 17:10276346-10276368 CCTTCCTCTTTTGTCCTTCGTGG + Intergenic
1149947934 17:60951844-60951866 ACTGCAGCCTCTGTCCTCCCGGG + Intronic
1151862836 17:76778308-76778330 GCTGCCGCCTTTGTAGCCCGCGG + Exonic
1154356871 18:13628063-13628085 CCTGCTCCCTGTGCCCTCCGAGG - Intronic
1156957268 18:42982296-42982318 CCTTCCGCATTTGTTCTCTGCGG + Intronic
1157911360 18:51620134-51620156 CCTGCCACCGTTGTTCTCTGTGG + Intergenic
1161009086 19:1951492-1951514 CCAGCTGCCTGTGTCCTCTGGGG + Intronic
1161727111 19:5935986-5936008 CCGGCAGCCTTTGCCCTCCTGGG + Intronic
1161828420 19:6585419-6585441 ACTGCAGCCTTTGACCTCCTGGG + Intronic
1163456783 19:17411429-17411451 ACTGCAGCCTTTGACCTCCTGGG + Intronic
1163541913 19:17916592-17916614 CCTGCAGCCTTTGTTCACCTTGG - Intergenic
1167859292 19:52270050-52270072 CCTGCCGCCGTAGTCCTCCTTGG + Intronic
1168596532 19:57682200-57682222 ACTGCCGCCATTGAGCTCCGTGG - Exonic
932278282 2:70468006-70468028 CCTGCCTCCTTGGTCCTCTGCGG + Intronic
939525502 2:143288784-143288806 GCTGCTGCCTTTGTTCTCGGGGG + Intronic
943645954 2:190408281-190408303 CCCTCCGCCTCCGTCCTCCGTGG + Intergenic
946054351 2:216887984-216888006 CCTGCCTCCTTAGTGCTCTGTGG + Intergenic
948634425 2:239325887-239325909 CCTGCAGCCTCTGTCCCCCGGGG - Intronic
948884648 2:240876675-240876697 CCTGCCACGTTTGTCCTCCTGGG + Intronic
1170607267 20:17883570-17883592 CCTGCTGCCCTTTTCCTCCGTGG + Intergenic
1171234472 20:23512875-23512897 CCTTCCTCCTCTGTCCTCCCAGG + Intergenic
1171417427 20:24992593-24992615 CCTGCCGTCCTTAGCCTCCGGGG + Exonic
1174085889 20:48006880-48006902 CCTCCTGCCTTTGACCTCCAGGG + Intergenic
1178703046 21:34850288-34850310 CCTGCTGCCTGTGTCCTTTGGGG - Intronic
1178922632 21:36748297-36748319 CCGCCCGCCTCTGTCCTGCGAGG + Exonic
1180002565 21:45001955-45001977 CCTGCCCCCTTAGGCCTCCAGGG + Intergenic
1181068414 22:20317440-20317462 CCTGCCTCCTTTGTGTTCCCTGG - Intronic
1181513764 22:23400348-23400370 CCTGCAGCCCCTGTGCTCCGAGG - Intergenic
1182047213 22:27284778-27284800 CCTGCCTCCTTTGCTCTCCAAGG + Intergenic
1182119759 22:27779103-27779125 CCTGCTGCCTTTGGCCCCTGAGG - Intronic
1182521312 22:30885942-30885964 ACTGCCCCCTTTGGCCTCCTTGG - Intronic
1184643944 22:45886059-45886081 TCAGCCGCCTTTGTTCTCCCAGG - Intergenic
1184672646 22:46023489-46023511 CCTCCCACCTTTGACCTCAGTGG - Intergenic
1184907291 22:47497457-47497479 CCTGCTGCCTTTCTCCCCTGAGG - Intergenic
1185113736 22:48919462-48919484 CCTGCCGCCTTGGTCGGACGAGG - Intergenic
1185269628 22:49923056-49923078 CCTGCCGCGTGGGGCCTCCGAGG + Intronic
950532022 3:13557762-13557784 ACTGCAGCCTTTCTCCTCTGGGG - Intronic
960067973 3:113395525-113395547 ACTGCCTCCTTTCTCTTCCGTGG - Intronic
960928501 3:122820693-122820715 CCTGCAGGCATTGTCCTCTGTGG + Intronic
961779900 3:129315348-129315370 CTTGCCGCCTTTGTCCTTCTTGG + Exonic
962382820 3:134911112-134911134 CCTGCAGCCTTTGAACTCCTGGG + Intronic
964625630 3:158756596-158756618 ACTGCAGCCTTTGACCTCCCAGG + Intronic
965337911 3:167450474-167450496 CATGCTTCCTTTGTCCTCTGAGG - Intronic
972290354 4:37685829-37685851 CCCGCCGCCCTTGTCCTCAAAGG - Intronic
978529938 4:109703065-109703087 CCTGCCGCCTTTGTCCTCCGGGG - Intronic
980167124 4:129242443-129242465 CCTGCTGCCTCTGGCCTCCATGG - Intergenic
981283226 4:142985037-142985059 CCTGCTGCTTTTGTTCTCAGTGG - Intergenic
981812494 4:148791503-148791525 CCTTCTGCCTTTTTCCTTCGTGG + Intergenic
985702901 5:1384231-1384253 GCTGTCCCCTCTGTCCTCCGTGG + Intergenic
987233784 5:15922473-15922495 CCTGCAGCTTCTGTTCTCCGAGG - Intronic
988825229 5:34929419-34929441 GCTCCCGCCTTTCTCCTGCGCGG + Intergenic
991771605 5:70046188-70046210 ACTGCAGCCTTTGACCTCCTTGG + Intergenic
991850897 5:70921606-70921628 ACTGCAGCCTTTGACCTCCTTGG + Intergenic
992962632 5:81971773-81971795 CGAGCCGCCTTTGTGCTCCGCGG + Intergenic
994450000 5:99929655-99929677 CCTGCCTCCTTGGCCCTCCCTGG - Intergenic
996719556 5:126616802-126616824 ACTGCAGCCTCTGCCCTCCGGGG - Intronic
997819766 5:137054572-137054594 ACTGACTCCTTTGTCCTCTGGGG - Intronic
998104493 5:139459765-139459787 CCAGCCGCCTCTGTCCACCCAGG - Intronic
998333488 5:141350314-141350336 CCTGCTGTCTTTGTTCTGCGGGG + Exonic
998341976 5:141426345-141426367 CCTGCTGCCTTTGTTCTGCGGGG + Intronic
999211984 5:149897653-149897675 ACTGCAGCCTTTGACCTCCATGG + Intronic
1001458043 5:171882375-171882397 ACTGCAGCCTTTGACCTCCCGGG + Intronic
1002643485 5:180641488-180641510 CTGGCTGCCTTTGTCCTCCTGGG - Intronic
1002724734 5:181286893-181286915 CCTGTTGCATTTGTCCTCAGGGG + Intergenic
1004492375 6:16129112-16129134 CCAGCTGCCCCTGTCCTCCGCGG - Exonic
1004720886 6:18266333-18266355 CCTGCCGCCTTGGCCCTCTCTGG - Intergenic
1007077633 6:39078147-39078169 CCTGCTGCCTCTGTTCTCCCAGG + Intronic
1012441786 6:99267710-99267732 CCTCCCGCCTTTCTTCTCCGAGG - Intergenic
1016614336 6:146029003-146029025 CCTGCCCCCTCTGTCCTCACGGG - Intronic
1019063084 6:169271236-169271258 CCTGCCGCCTTCCTGCTCTGGGG - Intergenic
1019462169 7:1166043-1166065 CCTGGCTCCTTTGTCCTCAGTGG + Intergenic
1020142595 7:5620773-5620795 CCTGCTCCCTTTGTCCTGCCTGG + Intronic
1022493456 7:30838165-30838187 CCTGCTGCCTTTCTCATCTGAGG + Intronic
1023643119 7:42281633-42281655 CCTGCCCCCATTGTCTTCTGGGG + Intergenic
1024982747 7:55171396-55171418 CGTGCCAACTTTGTCCTCAGTGG + Intronic
1032511159 7:132473391-132473413 CCTGCCGCCACTGCCCTCCTGGG - Intronic
1035227897 7:157443628-157443650 CCTGCAGCCTCTGCCCTCCTCGG + Intergenic
1036658021 8:10690386-10690408 CCTGCCCCCTTTGTGCTCCTGGG - Intronic
1037826167 8:22161928-22161950 CCTGCCTCCTCTATCCTCCCTGG + Intronic
1038010561 8:23472547-23472569 CCTGCCGCCTTGCTGCCCCGCGG - Intergenic
1040783628 8:51140247-51140269 CCTGCCAGCATTGTCCTCTGTGG - Intergenic
1044257437 8:90082283-90082305 CCATCCTCCTTTGTCCTCAGTGG - Intronic
1049277642 8:141727902-141727924 CCTCCCGCCTGTGTTCTCCGGGG - Intergenic
1049673856 8:143881083-143881105 CCTGCTGCCTCTGTCCCCCACGG + Intergenic
1049847148 8:144808349-144808371 CCTGCCCTCTGTGTCCTCCCCGG - Exonic
1053753006 9:41274537-41274559 AATGCCGCATTTGTCTTCCGAGG - Intergenic
1053884802 9:42636146-42636168 AATGCCGCATTTGTCTTCCGAGG + Intergenic
1054223823 9:62443597-62443619 AATGCCGCATTTGTCTTCCGAGG + Intergenic
1054258536 9:62838912-62838934 AATGCCGCATTTGTCTTCCGAGG - Intergenic
1054333242 9:63781155-63781177 AATGCCGCATTTGTCTTCCGAGG + Intergenic
1060517347 9:124274182-124274204 CCTGCGGCCTCTGTCCTCCATGG - Intronic
1061810737 9:133161677-133161699 CCAGCAGGCTTTGTCCTCCAAGG - Intronic
1062166205 9:135108763-135108785 CCTTCCTGCTTTGTCCTCCCTGG + Intronic
1062232275 9:135488100-135488122 GCTGCCGCCACTGTCCTCCGTGG - Exonic
1062379791 9:136281700-136281722 CCTGCCTCCTGTCTCCTCCACGG - Intronic
1202800242 9_KI270719v1_random:169462-169484 AATGCCGCATTTGTCTTCCGAGG + Intergenic
1186850416 X:13574420-13574442 CCTGCCCCCACTGTCCTCAGAGG - Intronic
1200584847 Y:4996135-4996157 CCTCCTGCCTTGGTCCTCCAAGG + Intergenic
1201627897 Y:16035278-16035300 CCTTCTGCCTGTGTCCTCAGAGG + Intergenic