ID: 978529940

View in Genome Browser
Species Human (GRCh38)
Location 4:109703066-109703088
Sequence CCCTGCCGCCTTTGTCCTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 1, 2: 4, 3: 29, 4: 365}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978529940_978529950 8 Left 978529940 4:109703066-109703088 CCCGGAGGACAAAGGCGGCAGGG 0: 1
1: 1
2: 4
3: 29
4: 365
Right 978529950 4:109703097-109703119 CGGCGCCGGCGTCGCTACTCGGG 0: 1
1: 0
2: 0
3: 2
4: 41
978529940_978529952 17 Left 978529940 4:109703066-109703088 CCCGGAGGACAAAGGCGGCAGGG 0: 1
1: 1
2: 4
3: 29
4: 365
Right 978529952 4:109703106-109703128 CGTCGCTACTCGGGACCGCCAGG No data
978529940_978529954 23 Left 978529940 4:109703066-109703088 CCCGGAGGACAAAGGCGGCAGGG 0: 1
1: 1
2: 4
3: 29
4: 365
Right 978529954 4:109703112-109703134 TACTCGGGACCGCCAGGAGGCGG 0: 1
1: 0
2: 1
3: 5
4: 79
978529940_978529953 20 Left 978529940 4:109703066-109703088 CCCGGAGGACAAAGGCGGCAGGG 0: 1
1: 1
2: 4
3: 29
4: 365
Right 978529953 4:109703109-109703131 CGCTACTCGGGACCGCCAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 60
978529940_978529945 -6 Left 978529940 4:109703066-109703088 CCCGGAGGACAAAGGCGGCAGGG 0: 1
1: 1
2: 4
3: 29
4: 365
Right 978529945 4:109703083-109703105 GCAGGGGCACGCCCCGGCGCCGG No data
978529940_978529949 7 Left 978529940 4:109703066-109703088 CCCGGAGGACAAAGGCGGCAGGG 0: 1
1: 1
2: 4
3: 29
4: 365
Right 978529949 4:109703096-109703118 CCGGCGCCGGCGTCGCTACTCGG 0: 1
1: 0
2: 0
3: 2
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978529940 Original CRISPR CCCTGCCGCCTTTGTCCTCC GGG (reversed) Intronic
900340206 1:2184901-2184923 CCCTGCCACCTTTGCCCACAGGG + Exonic
900610411 1:3542235-3542257 CAGTGCTGCCTTTGGCCTCCAGG - Intronic
901054379 1:6441917-6441939 CCCTGCAGCCTCTGGCCTCTGGG - Intronic
901631714 1:10651302-10651324 GCCTCCCGCCCTTCTCCTCCAGG - Intronic
901870592 1:12136571-12136593 CCCTGCAACCTCTGTCCCCCAGG - Intronic
901928538 1:12582679-12582701 CCTTGCAGCCATTGTCATCCAGG + Intronic
902456783 1:16539140-16539162 CCCTGTGGCCTTTATCCTGCTGG + Intergenic
902474294 1:16673077-16673099 CCCTGTGGCCTTTATCCTGCTGG + Exonic
902484509 1:16734365-16734387 CCCTGTGGCCTTTATCCTGCTGG - Exonic
902495386 1:16868772-16868794 CCCTGTGGCCTTTATCCTGCTGG - Intronic
904297149 1:29527302-29527324 ACCTGCTGCCCTTCTCCTCCAGG - Intergenic
905863775 1:41366174-41366196 CTCCTCCTCCTTTGTCCTCCGGG + Intronic
906790303 1:48653401-48653423 CCCTATTGCCTGTGTCCTCCGGG - Exonic
907673462 1:56497279-56497301 CCCAGCGTCCTTTTTCCTCCTGG + Intronic
908378367 1:63569958-63569980 CTCTGCCTCCTTTTTCCTCAAGG + Intronic
909126355 1:71675875-71675897 CACTGCTGCCTCTGACCTCCTGG + Intronic
909470972 1:76027786-76027808 CTCTGCCGCCTTTGTCCTCAGGG - Intergenic
909842742 1:80349318-80349340 CCCTGCCTACTTTGGTCTCCGGG + Intergenic
911328052 1:96492495-96492517 CACTGCCGCCTTTATTCTCCAGG - Intergenic
914349833 1:146831407-146831429 CCCTCCCACCCTTGTCCTGCAGG + Intergenic
915581644 1:156816475-156816497 CCCTGTCACCTTTATCCTCAGGG + Intronic
916073143 1:161183557-161183579 CACTGCCACCTTTGTCTCCCAGG + Intergenic
916741265 1:167649162-167649184 CCATTCCCTCTTTGTCCTCCTGG - Intronic
916881737 1:169025449-169025471 CCCTGCCTCATTGTTCCTCCAGG - Intergenic
918076675 1:181176006-181176028 TCCTGGCACCTGTGTCCTCCTGG - Intergenic
920191938 1:204199227-204199249 CCCTGTCGCCTTCGGCTTCCTGG - Exonic
920963449 1:210683641-210683663 GCCTGACGCTTTTGTCCTCTCGG + Exonic
922336861 1:224624934-224624956 TGCTGCAGCCTTTGTCCTCTAGG + Intronic
922697122 1:227736132-227736154 CCCTCCCACCATTTTCCTCCAGG - Intronic
922723842 1:227913572-227913594 CCTAAACGCCTTTGTCCTCCCGG + Intergenic
922744890 1:228038198-228038220 CCCGGCCGCCTGGCTCCTCCTGG + Intronic
924040146 1:239976563-239976585 CCCTGCAGCATTTGTCATGCAGG - Intergenic
924300359 1:242631850-242631872 CCCTGCAACCTCTGTCCCCCAGG + Intergenic
1063994613 10:11607608-11607630 CACTGCAGCCTTTGCCTTCCAGG - Intronic
1064437818 10:15326701-15326723 CACTGCAGCCTCTGTCCCCCAGG + Intronic
1065747398 10:28854939-28854961 CCCTTCCGCCCTGGCCCTCCAGG + Intronic
1065918508 10:30371388-30371410 CCCTGCAGCCTCTGCCTTCCAGG - Intronic
1066599844 10:37093133-37093155 CCCAGCCTACTTTTTCCTCCTGG - Intergenic
1067187736 10:44044589-44044611 CCCTGCCTCATTTCTCCCCCTGG + Intergenic
1068991713 10:63157654-63157676 CACTGCAGCCTTGATCCTCCCGG + Intergenic
1069632886 10:69908128-69908150 TCCTGCCTCTTTTCTCCTCCTGG - Intronic
1069951060 10:72018385-72018407 CCATGTCCCCTTTATCCTCCAGG - Intergenic
1072732832 10:97859285-97859307 CCCTGCCTCCCTTGGCCTCTTGG + Intronic
1072949237 10:99837942-99837964 CAATGCCGCCATTGTCATCCTGG + Intronic
1074142529 10:110686548-110686570 CACTGCAGCCTTTGAACTCCTGG - Intronic
1074880983 10:117658290-117658312 CACTGCAGCCTTTGCCCTCCTGG - Intergenic
1075325990 10:121532637-121532659 CACTGGAGCCTTTGTCTTCCTGG + Intronic
1075572636 10:123557001-123557023 CCCTGGCGTGTGTGTCCTCCTGG + Intergenic
1076106756 10:127829541-127829563 CCCTGAGGGCTTTATCCTCCTGG + Intergenic
1076388399 10:130076188-130076210 TCCTCCTCCCTTTGTCCTCCTGG - Intergenic
1076490589 10:130858784-130858806 AACTGCCACCTTTCTCCTCCAGG - Intergenic
1077243045 11:1521329-1521351 TCCTTCCTCCTTTGTCCTTCTGG - Intergenic
1077337944 11:2013818-2013840 CCCTGCCCGCTTTGTCCCCTGGG + Intergenic
1077378518 11:2216638-2216660 CCCTGCCCCCTTTCTCCTGGAGG + Intergenic
1077610182 11:3639169-3639191 CCCTTCCTCCTCCGTCCTCCAGG + Intronic
1078845803 11:15117438-15117460 CCCTGCCACCTTTATTCTGCTGG - Intronic
1079627941 11:22638419-22638441 CACTGCAGCCTTTGTCTCCCAGG + Intronic
1081623327 11:44632063-44632085 CCCTGCCTTCTCTCTCCTCCAGG - Intergenic
1082004293 11:47411123-47411145 CCCAGCTGCCTCTGTCCTCTAGG + Intronic
1082050782 11:47768857-47768879 CACTGCAGCCTCTGCCCTCCGGG + Intergenic
1083108830 11:60385310-60385332 CCTTGCCGCCTTTTGCCTCCTGG - Intronic
1083603733 11:63964473-63964495 CACTGCAGCCTCTGTCCCCCAGG + Intergenic
1083645391 11:64169458-64169480 CACTGCAGCCTCTGTCCCCCAGG + Intergenic
1084084702 11:66849667-66849689 CACTGCCACCTTTGGCCCCCTGG - Exonic
1084717578 11:70883553-70883575 CCCAGCCCCCTTTGTTCTCTTGG - Intronic
1085044392 11:73344675-73344697 CGCTGCCGCCTTTGCCTTCACGG + Intronic
1085109430 11:73874554-73874576 CACTGCAGCCTTTGAACTCCTGG - Intronic
1085375652 11:76058456-76058478 CACTGCAGCCTCTGACCTCCCGG - Intronic
1085718026 11:78890083-78890105 TACTGCCGCCTCTGGCCTCCAGG - Intronic
1086384319 11:86291574-86291596 CCCTGCAGCCTTTGTACTTCTGG - Intergenic
1087029325 11:93686241-93686263 CACTGCAGCCTTTGTCTCCCAGG - Intronic
1088781613 11:113140216-113140238 CCCTGCCTCCTGTGTCCTCAGGG + Intronic
1089374630 11:117985944-117985966 TCCTGGCGCCTTTGCCCTCAAGG + Intergenic
1089599642 11:119605473-119605495 CCCAGCCACCTCTGGCCTCCCGG + Intergenic
1089682112 11:120124330-120124352 CCCTGCCGAGTTTGTACCCCAGG + Intronic
1089777425 11:120848126-120848148 CCCTGCAGCATTCCTCCTCCAGG - Intronic
1090861160 11:130653837-130653859 CCCTGCAGCTTTTTTCCTCCCGG + Intergenic
1202820928 11_KI270721v1_random:69000-69022 CCCTGCCCGCTTTGTCCCCTGGG + Intergenic
1091831071 12:3551542-3551564 CCCTGGCGCCTGAGTCATCCGGG + Intronic
1092205541 12:6612653-6612675 CCCTTCCATCTTTGTCTTCCTGG - Intergenic
1092268896 12:7006292-7006314 CCCTGCAACCTCTGTCTTCCAGG + Intronic
1094056131 12:26271550-26271572 CCTTGCCGTCTTCCTCCTCCTGG - Intronic
1096530537 12:52239818-52239840 CCCTCTCACCCTTGTCCTCCGGG + Intronic
1097183773 12:57185460-57185482 CACTGGTGCCTTTGTCATCCAGG - Intronic
1097395341 12:59066494-59066516 CCCTGCCTCCTTCCTCCACCTGG - Intergenic
1099136399 12:78908987-78909009 CCATGCCCTCTTTGTCCTGCAGG - Intronic
1100596574 12:96077439-96077461 TCCTCCCACCTTTGTTCTCCTGG + Intergenic
1103736971 12:123066719-123066741 ACATGCAGCCTTTCTCCTCCAGG + Intronic
1104441402 12:128796351-128796373 CACTGCAGCCTTTCACCTCCCGG - Intronic
1105409701 13:20161303-20161325 CCCTGCCGCCTACGCACTCCGGG + Intergenic
1105517980 13:21107452-21107474 CACTGCAACCTTTGTCCCCCTGG - Intergenic
1106104355 13:26721420-26721442 CCCTGCCCCCTGTGGCCTCATGG + Intergenic
1106181804 13:27375894-27375916 CCCTACCACCTCTGTCCACCAGG + Intergenic
1106314238 13:28579261-28579283 GCCTGCCACATGTGTCCTCCTGG + Intergenic
1106440049 13:29758702-29758724 CACTGCCTCCTTTGCCATCCTGG - Intergenic
1108140510 13:47416108-47416130 CCCTCCTGGCTCTGTCCTCCAGG - Intergenic
1108217509 13:48199666-48199688 CCCTGCCCCCTTTCCCCTTCAGG + Intergenic
1108388506 13:49924349-49924371 CACTGCCGCCTTTATCTCCCAGG + Intronic
1108389061 13:49929863-49929885 CACTGCAGCCTCTGTCTTCCGGG + Intronic
1109819876 13:67638878-67638900 CCCTGCCACCATTGTCTTGCTGG - Intergenic
1111951853 13:94713772-94713794 GCCCGCCGCCTTCTTCCTCCCGG - Intergenic
1112008904 13:95277669-95277691 CACTGGGGGCTTTGTCCTCCTGG - Intronic
1113837381 13:113337217-113337239 CACTGCAGCCTTTGACCTCCTGG - Intronic
1114824640 14:26062396-26062418 CCCTGCCGCCTCTGTCCATGAGG + Intergenic
1117710189 14:58520595-58520617 CACTGCAGCCTCTGACCTCCCGG + Intronic
1118014016 14:61640301-61640323 CCCTGCCTTCAGTGTCCTCCTGG + Intronic
1118076021 14:62300125-62300147 CACTGCAGCCTTGATCCTCCTGG + Intergenic
1121002797 14:90464357-90464379 CCCTCCCTCCTCTGTGCTCCTGG + Intergenic
1121367974 14:93332483-93332505 CCCGGCCGGCTTTGGGCTCCGGG - Intronic
1121629161 14:95410049-95410071 CCCTCCCGTCTTTGTCCTGGCGG - Intronic
1121631155 14:95422823-95422845 CCCTGCTGGCTTCCTCCTCCTGG + Intronic
1122451839 14:101815147-101815169 CCCTGCCTTTTTTGTCCCCCCGG + Intronic
1124373029 15:29114216-29114238 CCCAGCAGCCTGTGCCCTCCCGG - Intronic
1125414864 15:39441984-39442006 CCCTGCCACCCTTCTCCCCCAGG - Intergenic
1125606430 15:40942120-40942142 CCCTGCCGCCTTCGTCCCATCGG - Intergenic
1127159447 15:56165975-56165997 CACTGCAGCCTTTGACCTCCTGG + Intronic
1127418641 15:58782993-58783015 CACTGCAGCCTTTGTCTTCTGGG + Intronic
1128705906 15:69837434-69837456 CCCGGGAGCCTGTGTCCTCCAGG + Intergenic
1128788039 15:70412670-70412692 CACTCCAGCCTTTGTCATCCAGG + Intergenic
1129740231 15:77986426-77986448 CGCTGCCCCCTTTGTCCTGTCGG + Intronic
1129870069 15:78934379-78934401 CCCTGCCCCCGCTGTTCTCCCGG - Intronic
1131074452 15:89486454-89486476 CCCTGCAGCCTTTGTCGTAGGGG + Intronic
1131147214 15:90021779-90021801 CCATGCCGCCTTTGTCTGCTAGG - Intronic
1131564315 15:93472158-93472180 CCCTTCCGCTTCTGACCTCCGGG - Intergenic
1132388312 15:101418586-101418608 CACTGCAGCCTTTGTCTCCCAGG + Intronic
1132861897 16:2075959-2075981 CCCGGCAGCCTTTGTCCCCAAGG + Intronic
1133898795 16:9953772-9953794 CCTTTCAGCCTTTGTCTTCCTGG - Intronic
1135304113 16:21354381-21354403 TCATGCAGGCTTTGTCCTCCGGG + Intergenic
1135471352 16:22734333-22734355 TCTTGCCACCTTTGCCCTCCAGG + Intergenic
1135886079 16:26309420-26309442 CCCTACTGACTTTGTCCTCATGG + Intergenic
1136022586 16:27449367-27449389 ACCTGCAGCCTTTGGTCTCCTGG + Exonic
1136300848 16:29333516-29333538 TCATGCAGGCTTTGTCCTCCGGG + Intergenic
1136474294 16:30502887-30502909 CACTGCAGCCTCTGCCCTCCTGG + Intronic
1136504899 16:30696849-30696871 CCCTGCAGCCTCTGTCTCCCGGG - Intergenic
1137589577 16:49685445-49685467 CCCTACCAGCTTTGTCCCCCAGG + Intronic
1137595216 16:49719139-49719161 CCCTGCTGCCTTTCTCCTGGAGG - Intronic
1137825322 16:51489723-51489745 CTCTGCAGCCTGTGTCCTCAGGG - Intergenic
1137834137 16:51574528-51574550 CACTGCAGCCTTTGACCTCCTGG + Intergenic
1137889718 16:52146430-52146452 CCCTGGCTCCTTTGACCTCCTGG + Intergenic
1138349557 16:56339244-56339266 CCCTGCCGCCTGTGTGATCATGG + Intronic
1138580950 16:57940103-57940125 CCCTGCTCCCTCTGTCCTGCGGG + Intronic
1139659688 16:68412111-68412133 CCCAGCCTCCTCTGGCCTCCCGG - Intronic
1139984203 16:70884124-70884146 CCCTCCCACCCTTGTCCTGCAGG - Exonic
1140864334 16:79046783-79046805 CCCTGCTCTCTTTGTCCCCCAGG + Intronic
1141407900 16:83809542-83809564 CCCTGCAACCTTTGCCCTCCTGG + Intronic
1141680020 16:85538464-85538486 CCCAGCAGCCTTTCACCTCCTGG + Intergenic
1142031509 16:87840757-87840779 CCCTGCGGCCCCTTTCCTCCAGG - Intronic
1142112674 16:88340668-88340690 ACCTGCCTCCTCTGTGCTCCCGG - Intergenic
1142203925 16:88773787-88773809 CCCTGCACCCAGTGTCCTCCTGG + Intronic
1142253315 16:89002538-89002560 CCCCGGCTCCTCTGTCCTCCCGG - Intergenic
1142253349 16:89002640-89002662 CCCCGGCTCCTCTGTCCTCCCGG - Intergenic
1142253432 16:89002873-89002895 CCCCGGCTCCTCTGTCCTCCCGG - Intergenic
1142852063 17:2709097-2709119 CTCTGCCGCCTTTGAGCTCCCGG - Intronic
1143979556 17:10856818-10856840 CCCTGTTGCATTTGTCCTTCAGG - Intergenic
1144868351 17:18351918-18351940 CACTGCAGCCTTTGATCTCCTGG + Intronic
1145057443 17:19712802-19712824 CCCTCTCCCCTGTGTCCTCCAGG + Intronic
1145771654 17:27497533-27497555 TCCTGCGGCCTGTTTCCTCCTGG - Intronic
1145897209 17:28466101-28466123 GCCTGCCTCCTTTTCCCTCCAGG - Intronic
1147055259 17:37829243-37829265 CCCTGCTGCCTGTGTGCTCTTGG + Intergenic
1147597109 17:41724397-41724419 CCCTGCCTCCTCTATCCCCCAGG - Exonic
1148124286 17:45229022-45229044 CCTCGCCTCCTTTGTACTCCTGG + Intronic
1149375522 17:56040199-56040221 CCTTCCTGCCTTTCTCCTCCAGG + Intergenic
1149782919 17:59412231-59412253 CACTGCAGCCTCTGTCCCCCAGG - Intergenic
1149947933 17:60951843-60951865 CACTGCAGCCTCTGTCCTCCCGG + Intronic
1150241086 17:63633150-63633172 CACTGCAGCCTTTGCCTTCCAGG - Intronic
1150462140 17:65361816-65361838 CCCTGGCCCCCCTGTCCTCCAGG + Intergenic
1151415063 17:73956779-73956801 CCCTGCAGGCCTTGGCCTCCTGG + Intergenic
1152228151 17:79102149-79102171 CCCTGTCGGCCTCGTCCTCCAGG - Intronic
1152614189 17:81330359-81330381 CCCTGCCCCTCTCGTCCTCCTGG - Exonic
1153554087 18:6292744-6292766 CCCTGAGTACTTTGTCCTCCTGG - Intronic
1155169983 18:23260086-23260108 CCCTGCTGCCCGTTTCCTCCTGG - Exonic
1156049203 18:32911652-32911674 CCCTGCAGCATTTGTATTCCTGG + Intergenic
1156468299 18:37361898-37361920 CCCTCCTGCCTTTCTCTTCCCGG - Intronic
1158143816 18:54287653-54287675 CACTGCAGCCTTTGTCTCCCAGG + Intronic
1158350823 18:56563160-56563182 CCTTCCCAGCTTTGTCCTCCCGG - Intergenic
1160697342 19:491557-491579 CTCTGACGCCTTGGTGCTCCCGG - Intronic
1160814841 19:1030236-1030258 CCCTGCCACCTTTCTGCACCCGG - Intronic
1160859972 19:1233601-1233623 CCCTCCAGCCTTGGTGCTCCTGG + Exonic
1161009084 19:1951491-1951513 CCCAGCTGCCTGTGTCCTCTGGG + Intronic
1161014642 19:1977675-1977697 CACTGCAGCCTTTGTCTCCCAGG - Intronic
1161035368 19:2081510-2081532 CACTGCAACCTTTGTCCCCCGGG - Intronic
1161233323 19:3186349-3186371 CCCTGCCGCCCTGGACCCCCGGG + Intronic
1161571409 19:5032741-5032763 CCCAGCCGCCTTTGTCCTCCTGG + Intronic
1161727109 19:5935985-5936007 GCCGGCAGCCTTTGCCCTCCTGG + Intronic
1161828419 19:6585418-6585440 CACTGCAGCCTTTGACCTCCTGG + Intronic
1162087460 19:8257214-8257236 CCCTGCCCCCTCTGTCTTCCAGG + Intronic
1162088212 19:8261259-8261281 CCCTGCTCCCTGTGTCTTCCTGG + Intronic
1162115512 19:8426913-8426935 CCCTACCGCCCCTGTCCACCAGG + Intronic
1162323670 19:9985934-9985956 CCTTTCCGCCTCTGACCTCCAGG - Intronic
1163456782 19:17411428-17411450 CACTGCAGCCTTTGACCTCCTGG + Intronic
1164010257 19:21196605-21196627 CACTGCAGCCTCTGTCCTCTGGG - Intergenic
1164652150 19:29898809-29898831 CAATGCCGCCATTGTCATCCTGG + Intergenic
1165144107 19:33720696-33720718 CCCTGCCTCCTGTGTCCCCATGG - Intronic
1165838954 19:38775410-38775432 CCCTGCAGCCTCTGATCTCCTGG - Intergenic
1166047684 19:40238973-40238995 CCCTGCTGCCTTCATCCCCCAGG - Exonic
1167059068 19:47132035-47132057 CACTGCAGCCTCTGGCCTCCCGG + Intronic
1167122274 19:47524800-47524822 CACTGCACCCTTTGACCTCCTGG - Intronic
1167391917 19:49200769-49200791 CCCTACCGTCCATGTCCTCCTGG - Exonic
1168107356 19:54173033-54173055 CCCTACCTCCTCTGGCCTCCCGG + Exonic
1168344511 19:55643784-55643806 CCCAGCCCCCTTCCTCCTCCCGG - Intronic
1202707671 1_KI270713v1_random:35481-35503 CCCTGTGGCCTTTATCCTGCTGG + Intergenic
925187146 2:1856255-1856277 CCTTGTCCCCTTTGTGCTCCTGG + Intronic
925439184 2:3869042-3869064 CCCACCTGCCTCTGTCCTCCAGG + Intergenic
925993666 2:9274396-9274418 CACTGCAACCTTTGTCCCCCAGG + Intronic
926274281 2:11391720-11391742 CCCTGCCGCCTCTACCTTCCCGG + Intergenic
926295615 2:11566541-11566563 CCCTGCGGGCTTTCTCCTCGTGG + Exonic
926305084 2:11632412-11632434 CACTGCAGCCTTTGTCTTACGGG + Intronic
926312309 2:11683612-11683634 CCCTGCCTCCTGCCTCCTCCTGG + Intronic
926697694 2:15782302-15782324 CCCGCCCGCCTTTGTTCTCCAGG - Intergenic
926801751 2:16665647-16665669 CCCTGCCATCCTTCTCCTCCCGG - Intronic
926896387 2:17693922-17693944 CACTGCAGCCTCTGTCCCCCGGG - Intronic
927217539 2:20676543-20676565 CCCTGCAGTCTGTGTCCACCAGG - Intergenic
927493065 2:23533169-23533191 CTCTGCTGCCTTTGACCCCCAGG - Intronic
927894610 2:26773686-26773708 CACTGCAGCCTCTGTCCCCCAGG + Intronic
928114221 2:28535407-28535429 GCCTGGCTCCTTTGGCCTCCTGG + Intronic
930725849 2:54680698-54680720 GCCTGGTGCCCTTGTCCTCCTGG - Intergenic
931859156 2:66335501-66335523 CCGTGCTGCCCTTGTCCTCAAGG - Intergenic
932573636 2:72951074-72951096 CCCTGCAGCCCCTGCCCTCCAGG - Intronic
936516811 2:113186132-113186154 CCCTGCCTCCTTTTTCTTCAAGG - Exonic
938536592 2:132253636-132253658 CCCTGCCGACTCCGTCCCCCCGG - Intronic
938662185 2:133498515-133498537 CCCTGCCGCCCTTTTCTTCTTGG - Intronic
939210942 2:139174247-139174269 CACTGCAACCTTTGGCCTCCTGG - Intergenic
939258121 2:139771446-139771468 CCCTGCAGCCTTTGATCTCATGG - Intergenic
940278217 2:151961814-151961836 CACTGCAGCCTTGGACCTCCTGG - Intronic
940524983 2:154801700-154801722 CACTGCAGCCTTTACCCTCCAGG + Intronic
943064051 2:183068984-183069006 CCCTGCCACCTTAGCCCTCTTGG + Intergenic
947203091 2:227633671-227633693 CACTGCAGCCTTTGTCTCCCAGG - Intergenic
948599350 2:239099636-239099658 CTCTGCCGCCCTTGCCCTCTAGG + Intronic
948634427 2:239325888-239325910 TCCTGCAGCCTCTGTCCCCCGGG - Intronic
948884646 2:240876674-240876696 GCCTGCCACGTTTGTCCTCCTGG + Intronic
948897502 2:240934182-240934204 CCCTGCCTTCCTGGTCCTCCAGG + Intronic
948920146 2:241062495-241062517 CCCTGAGGCCTTTGTCCTGTCGG + Intronic
1169471104 20:5886316-5886338 CACTGCAGCCTCTGACCTCCTGG + Intergenic
1169682248 20:8228463-8228485 CACCCCCGCATTTGTCCTCCAGG + Intronic
1172793039 20:37519325-37519347 CCCTGCTGCCTTGGTGATCCCGG - Exonic
1173033965 20:39390708-39390730 CCATGCTGCCTCTGTGCTCCTGG + Intergenic
1173662501 20:44744414-44744436 GCCTGCCGCCTAGGCCCTCCAGG - Intergenic
1173972793 20:47165526-47165548 CCCTGCTGCCGTTGGTCTCCAGG + Intronic
1174085887 20:48006879-48006901 CCCTCCTGCCTTTGACCTCCAGG + Intergenic
1174482695 20:50842490-50842512 CACTGCAACCTTTGGCCTCCTGG + Intronic
1175340864 20:58228362-58228384 CCCTGACGTCTTCGTCCTGCGGG - Exonic
1175437277 20:58962394-58962416 CACTGCCACCTCTGCCCTCCCGG + Intergenic
1175916315 20:62427613-62427635 CTCTGCCTCCTTTCTGCTCCTGG - Intergenic
1178251865 21:31010888-31010910 CTCTGCCACATTTCTCCTCCTGG + Intergenic
1178442417 21:32609687-32609709 CACTGCCACCTCTGTCTTCCAGG - Intronic
1178720826 21:35007569-35007591 CCCTGCAGTGTTTCTCCTCCAGG + Intronic
1179525084 21:41970901-41970923 CCCTGGCTCCCTCGTCCTCCCGG + Intergenic
1180002563 21:45001954-45001976 CCCTGCCCCCTTAGGCCTCCAGG + Intergenic
1180116788 21:45712776-45712798 CACTGCAGCCTTTGACTTCCTGG + Intronic
1180189918 21:46157931-46157953 GCCTCCCTGCTTTGTCCTCCTGG - Intergenic
1180831438 22:18908927-18908949 TCCTGCCTCCTTTGTGTTCCCGG + Intronic
1182025492 22:27114929-27114951 CACTGCAGCCTCTGTCCCCCAGG - Intergenic
1183215149 22:36474535-36474557 CCCTCCCTCCTTCCTCCTCCAGG - Intronic
1183370293 22:37428014-37428036 CCCTGCCGCCTGCGCCCTGCTGG + Intergenic
1183567590 22:38626796-38626818 CACTGCAACCTCTGTCCTCCTGG - Intronic
1183704935 22:39470418-39470440 CCTTGCCTCCCTTGTCCCCCAGG - Intronic
1185096457 22:48808593-48808615 CCCTGCCTCCGCTGTCCTCTTGG - Intronic
1185316865 22:50183097-50183119 CCCGGCTGGCTTTGTCCTCAAGG - Intergenic
1203281522 22_KI270734v1_random:134198-134220 TCCTGCCTCCTTTGTGTTCCCGG + Intergenic
950462582 3:13134272-13134294 CTCAGCCACCTTTGACCTCCAGG + Intergenic
950532023 3:13557763-13557785 CACTGCAGCCTTTCTCCTCTGGG - Intronic
950644178 3:14367337-14367359 TCCTTCCGCCTCTGTCCTGCTGG - Intergenic
950649429 3:14397925-14397947 CCCTGCCACCTGTGTGCTCCAGG - Intergenic
952826623 3:37530042-37530064 CCCTGATTCCCTTGTCCTCCTGG - Intronic
954686135 3:52371287-52371309 CCTTTCCACCTCTGTCCTCCTGG - Intronic
954711122 3:52505579-52505601 CCCTGCCACCTTTGGCCTGCAGG - Intronic
955715493 3:61825070-61825092 CCCTGACTCCTTTCTCCTCTAGG + Intronic
957042248 3:75344840-75344862 CACTGCTGCCTTTGTCCTGGTGG + Intergenic
958137713 3:89518381-89518403 CCCTGCAGCCTTGGTCTCCCAGG + Intergenic
960732559 3:120742902-120742924 CCCTGTTGCCTTGGTCCTCTTGG + Intronic
961246938 3:125462513-125462535 CACTGCAGCCTTGGACCTCCTGG - Intronic
962382818 3:134911111-134911133 TCCTGCAGCCTTTGAACTCCTGG + Intronic
962721303 3:138177594-138177616 CACTGCAGCCTCTGTCTTCCAGG - Intergenic
963602661 3:147391448-147391470 CCCTCCCGCCTTCCTCCTCTGGG + Intronic
965197972 3:165624020-165624042 CCCTGCAGCCTTGCTCCTCTAGG - Intergenic
967448734 3:189597851-189597873 CACTGCAGCCCTTGACCTCCTGG - Intergenic
967529785 3:190535186-190535208 CCCTGCGGCCTTTGTTCTGGAGG + Intronic
967867799 3:194204352-194204374 CGCGGCCGCCTTTGTCCCTCCGG + Intergenic
968053132 3:195669927-195669949 CACTGCAGCCTTTGTCTCCCAGG + Intergenic
968102681 3:195978434-195978456 CACTGCAGCCTTTGTCTCCCAGG - Intergenic
968340242 3:197949715-197949737 TCCTGCTGCCTTCGTGCTCCCGG + Intronic
968769142 4:2492713-2492735 CCTGGCCGCCATTGTGCTCCAGG + Intronic
969248785 4:5953844-5953866 CCTTGCCACCTATGTCCACCTGG - Intronic
971340434 4:25763762-25763784 CACTGCAGCCTTGGTCCCCCAGG - Intronic
971431055 4:26567995-26568017 CACTGCAGCCCTTGACCTCCTGG + Intergenic
971913008 4:32821173-32821195 CCCTGCAGCCTTTGTTTCCCAGG + Intergenic
974505494 4:62765237-62765259 CCCTGCCTGCTTTGTCAGCCAGG - Intergenic
975336565 4:73183527-73183549 CACTGCAGCCTCTGGCCTCCTGG + Intronic
975555958 4:75664771-75664793 CACTGCAACCTTTGTCCCCCAGG - Intronic
975633795 4:76425854-76425876 CCCTGCTTCCTTTGTCCCCATGG - Intergenic
978529940 4:109703066-109703088 CCCTGCCGCCTTTGTCCTCCGGG - Intronic
978937008 4:114389647-114389669 CCCTGCCACCTCTGTCATGCAGG - Intergenic
979583905 4:122391783-122391805 CACTGCAACCTTTGTCTTCCAGG + Intronic
981264820 4:142769836-142769858 CACTGCCACCTCTGTCTTCCTGG - Intronic
982660046 4:158195789-158195811 CCCTACAGCCTTTGTCTTCGGGG + Intergenic
985499384 5:232284-232306 CACTGCAGCCTTTGTCTCCCAGG + Intronic
986128544 5:4906040-4906062 CCCTGCCGCCTTTGTCCACAAGG + Intergenic
987334325 5:16885594-16885616 CACTGCAACCTCTGTCCTCCGGG - Intronic
988229191 5:28452067-28452089 CACTGCAGCCTCTTTCCTCCTGG + Intergenic
989633961 5:43514987-43515009 CCCTGCCACCTTATTCCTCTAGG - Exonic
995806972 5:116063929-116063951 CACTGCAGCCTTGGACCTCCTGG - Intergenic
995829681 5:116341549-116341571 CCCTTCCACTTTGGTCCTCCAGG - Intronic
996719557 5:126616803-126616825 CACTGCAGCCTCTGCCCTCCGGG - Intronic
997819767 5:137054573-137054595 CACTGACTCCTTTGTCCTCTGGG - Intronic
998341974 5:141426344-141426366 TCCTGCTGCCTTTGTTCTGCGGG + Intronic
999163448 5:149526210-149526232 TCCTGCAGCCTTTGACCTTCTGG + Intronic
999824808 5:155263848-155263870 CCCTGTCTCCTCTGTGCTCCTGG - Intergenic
1000348697 5:160335644-160335666 CGCTGCAGCCTTTGAACTCCTGG + Intronic
1001458042 5:171882374-171882396 TACTGCAGCCTTTGACCTCCCGG + Intronic
1001964896 5:175903215-175903237 CTCTGCCTCGTCTGTCCTCCTGG + Intergenic
1002643486 5:180641489-180641511 TCTGGCTGCCTTTGTCCTCCTGG - Intronic
1002724732 5:181286892-181286914 CCCTGTTGCATTTGTCCTCAGGG + Intergenic
1003502360 6:6713009-6713031 CCCTGCTGCCTTTGTCTCCCTGG - Intergenic
1004394496 6:15236128-15236150 CCCTGCAACCTGTGTCCCCCAGG + Intergenic
1004941043 6:20556287-20556309 CACTGCAGCCTCTGCCCTCCAGG - Intronic
1006773499 6:36573733-36573755 CACTGCAGCCTCTGTCCCCCAGG + Intergenic
1006987915 6:38189061-38189083 CCCTGCATCCTCTGCCCTCCAGG + Intronic
1007296185 6:40823142-40823164 CCTTGCCCCCTTTATTCTCCTGG - Intergenic
1007319677 6:41018490-41018512 GCCTGCTGCCTCTCTCCTCCTGG - Intergenic
1011547368 6:88495911-88495933 CCCTGCCTGTTTTTTCCTCCTGG - Intergenic
1013586369 6:111582429-111582451 CCCAGTCTCCTTTGTCATCCAGG - Intronic
1015871173 6:137778068-137778090 CTCTGCTGTCTCTGTCCTCCTGG + Intergenic
1016614338 6:146029004-146029026 TCCTGCCCCCTCTGTCCTCACGG - Intronic
1017198784 6:151730222-151730244 CCCTGCTGCCTTCGACCCCCCGG + Intronic
1018610292 6:165641915-165641937 CCCCGCAGCCTCTGTCCTGCAGG + Intronic
1018638414 6:165885023-165885045 CCCTGCCGCCGTTTACCGCCAGG + Intronic
1019063086 6:169271237-169271259 CCCTGCCGCCTTCCTGCTCTGGG - Intergenic
1019435474 7:1020240-1020262 CGCTGCAGCCTCTGCCCTCCTGG + Intronic
1019666449 7:2254382-2254404 CCGTCACGCCTTTGTCTTCCAGG + Exonic
1019920724 7:4161665-4161687 CCCTGCCTCCTTCCTTCTCCAGG - Intronic
1022681081 7:32546746-32546768 CACTGCAGCCTCTGCCCTCCTGG - Intronic
1022792787 7:33705398-33705420 TCCTTCTGCCTTTGTCTTCCTGG + Intergenic
1023989909 7:45122465-45122487 GCCTGCCTCCTATGTCCTGCCGG + Intergenic
1024355549 7:48410469-48410491 TCCTGGGGCCTTTGTCCTCCTGG + Intronic
1025922561 7:65927209-65927231 CACTGCAACCTTTGTCTTCCAGG - Intronic
1028719558 7:94012954-94012976 CTGTGCCTCCTTTGTCCTACAGG - Intergenic
1029231459 7:99072565-99072587 CACTGCAGCCTTCGTCCCCCAGG - Intronic
1029404490 7:100366513-100366535 CCCTGCCCCTCTTGTCCCCCTGG - Intronic
1029617150 7:101666154-101666176 CCCTGCTGCCATCCTCCTCCCGG + Intergenic
1032199117 7:129806664-129806686 CACTGCAGCCTCTGACCTCCTGG - Intergenic
1032511161 7:132473392-132473414 ACCTGCCGCCACTGCCCTCCTGG - Intronic
1033403793 7:141052592-141052614 CACTGCAGCCTCTGTCTTCCCGG + Intergenic
1033571695 7:142635764-142635786 CACTGCAGCCTTTGTCTCCCGGG - Intergenic
1033801713 7:144909398-144909420 CCCTGCAGCCTTTCTCCTTCAGG + Intergenic
1035444656 7:158932129-158932151 CCCTGCAGGCAATGTCCTCCTGG - Intronic
1035759916 8:2061654-2061676 GCCTGGGGCCTTTGTCCTGCTGG + Intronic
1036658023 8:10690387-10690409 CCCTGCCCCCTTTGTGCTCCTGG - Intronic
1036672661 8:10802630-10802652 CCCTGCCCTCTGTGTACTCCTGG - Intronic
1037349851 8:17941019-17941041 ACCTGCCTCCTTTCTCTTCCCGG + Intronic
1037913337 8:22757433-22757455 CCCTGCCGCTTCCTTCCTCCAGG + Intronic
1039505628 8:38050422-38050444 CACTGCAGCCTTGGACCTCCTGG + Intronic
1039797283 8:40926123-40926145 CCCTGCCACGTTGGTACTCCTGG + Intergenic
1039961435 8:42250805-42250827 CACTGCAGCCTTGATCCTCCAGG - Intergenic
1040533153 8:48282404-48282426 CTCTCCTGCCTTTGTGCTCCAGG + Intergenic
1040859198 8:51981928-51981950 CCCTGCAACCTCTGCCCTCCCGG + Intergenic
1041011346 8:53547022-53547044 CTTTGCCTCCTTTGTGCTCCCGG - Intergenic
1043141812 8:76599766-76599788 CAATGCCACCTTTATCCTCCAGG + Intergenic
1045342605 8:101267991-101268013 CCCTGCAGCCTTTGGAGTCCAGG + Intergenic
1047681070 8:127254580-127254602 CCCTGCAGCCTCTGCCTTCCAGG - Intergenic
1049240068 8:141533191-141533213 CCCTGCCCCCTCCTTCCTCCAGG + Intergenic
1049277644 8:141727903-141727925 CCCTCCCGCCTGTGTTCTCCGGG - Intergenic
1049479634 8:142815714-142815736 CCCTGCTGCCTCTGGCCTCCTGG + Intergenic
1049807251 8:144546669-144546691 TCCTGCGGCCTCTGTCCTCCCGG + Intronic
1052100495 9:24440607-24440629 CCCTGCCCACTTTGCCCACCAGG - Intergenic
1053467166 9:38316959-38316981 CCCTGCCGCACTTGGCCTCATGG + Intergenic
1055317017 9:75043745-75043767 CCCTGCCACCTCTGCCTTCCAGG - Intergenic
1056148216 9:83756393-83756415 CACTGCAACCTTCGTCCTCCAGG - Intronic
1056655064 9:88502497-88502519 GCCTGCAGCCTTTGTCCTCCAGG - Intergenic
1056665997 9:88581285-88581307 CCCAGCCAGCTTTGTCCTCTTGG - Intronic
1056716804 9:89038046-89038068 CCCGGGCTCCTTTGTCCTCACGG - Exonic
1056733563 9:89185608-89185630 TCCTGCTGGCTGTGTCCTCCAGG - Intergenic
1056771669 9:89482016-89482038 CCCTGCCTCCTTTCCCCTCTTGG - Intronic
1056800163 9:89685600-89685622 CACTGCCTCCCTTGTCATCCTGG + Intergenic
1057596390 9:96418692-96418714 CCCCGCCGCCCTTGTCTCCCTGG - Intergenic
1057885174 9:98824320-98824342 CTCTGCTGCCTTGGTCCTCATGG + Intronic
1058437989 9:104981590-104981612 CCCTGCCTCAATTGTCCTCTAGG - Intergenic
1060342385 9:122788968-122788990 CCCTGCTGAATTCGTCCTCCTGG + Exonic
1061049133 9:128183839-128183861 CACTGCAGCCTCTGTCTTCCAGG + Intronic
1061231275 9:129317281-129317303 CCCTGCAGCCTTGATCTTCCGGG + Intergenic
1061490268 9:130940316-130940338 CCCAGCCGCCTTTTCCTTCCAGG + Intergenic
1061870301 9:133516833-133516855 CCCTCCCTCCTTCTTCCTCCCGG + Intronic
1062219648 9:135408300-135408322 CACTTCCACCTCTGTCCTCCTGG + Intergenic
1062324873 9:136007987-136008009 CCTGGCCTCCTTTCTCCTCCAGG - Exonic
1062546259 9:137064956-137064978 CCCTGCCCCCGTCCTCCTCCGGG - Exonic
1062602523 9:137324247-137324269 CCAGGCCCCTTTTGTCCTCCAGG + Intronic
1185747891 X:2586063-2586085 CCCTCCCACCTGTGTCATCCTGG - Intergenic
1185825812 X:3248608-3248630 CACTGCAGCCTCTGTCTTCCAGG + Intergenic
1187886670 X:23895061-23895083 CACTGCAGCCTTTTGCCTCCTGG - Intronic
1189354939 X:40303464-40303486 CCTTTCCCCCTTTGTCCACCTGG - Intergenic
1189823280 X:44891681-44891703 CCCTGCCTCCTTTGTTCTGTGGG - Intronic
1195246048 X:102996283-102996305 CCTTGCTGCCTTTGGCCACCTGG - Intergenic
1196379004 X:115068979-115069001 CCTTGCCGCCTTCGTCATCTCGG + Intergenic
1197760593 X:130025206-130025228 CCGGGCAGCCTCTGTCCTCCAGG - Exonic
1200150231 X:153947797-153947819 CGCAGCAGCCTGTGTCCTCCAGG - Exonic
1201253185 Y:12081228-12081250 CGCTGCAGCCTCTGTCTTCCAGG - Intergenic
1201375855 Y:13318082-13318104 CACTGCAGCCTTTGTCTTCCAGG - Intronic
1201784876 Y:17764286-17764308 CCCTGCAGCCTCTGCCTTCCAGG + Intergenic
1201816676 Y:18141701-18141723 CCCTGCAGCCTCTGCCTTCCAGG - Intergenic
1202344693 Y:23909107-23909129 CCCTGCAGCCTCTGCCTTCCAGG + Intergenic
1202526075 Y:25760976-25760998 CCCTGCAGCCTCTGCCTTCCAGG - Intergenic