ID: 978529942

View in Genome Browser
Species Human (GRCh38)
Location 4:109703067-109703089
Sequence CCCCTGCCGCCTTTGTCCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 237}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978529942_978529955 30 Left 978529942 4:109703067-109703089 CCGGAGGACAAAGGCGGCAGGGG 0: 1
1: 1
2: 0
3: 22
4: 237
Right 978529955 4:109703120-109703142 ACCGCCAGGAGGCGGCAGCCAGG 0: 1
1: 0
2: 0
3: 26
4: 244
978529942_978529952 16 Left 978529942 4:109703067-109703089 CCGGAGGACAAAGGCGGCAGGGG 0: 1
1: 1
2: 0
3: 22
4: 237
Right 978529952 4:109703106-109703128 CGTCGCTACTCGGGACCGCCAGG No data
978529942_978529953 19 Left 978529942 4:109703067-109703089 CCGGAGGACAAAGGCGGCAGGGG 0: 1
1: 1
2: 0
3: 22
4: 237
Right 978529953 4:109703109-109703131 CGCTACTCGGGACCGCCAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 60
978529942_978529954 22 Left 978529942 4:109703067-109703089 CCGGAGGACAAAGGCGGCAGGGG 0: 1
1: 1
2: 0
3: 22
4: 237
Right 978529954 4:109703112-109703134 TACTCGGGACCGCCAGGAGGCGG 0: 1
1: 0
2: 1
3: 5
4: 79
978529942_978529945 -7 Left 978529942 4:109703067-109703089 CCGGAGGACAAAGGCGGCAGGGG 0: 1
1: 1
2: 0
3: 22
4: 237
Right 978529945 4:109703083-109703105 GCAGGGGCACGCCCCGGCGCCGG No data
978529942_978529949 6 Left 978529942 4:109703067-109703089 CCGGAGGACAAAGGCGGCAGGGG 0: 1
1: 1
2: 0
3: 22
4: 237
Right 978529949 4:109703096-109703118 CCGGCGCCGGCGTCGCTACTCGG 0: 1
1: 0
2: 0
3: 2
4: 37
978529942_978529950 7 Left 978529942 4:109703067-109703089 CCGGAGGACAAAGGCGGCAGGGG 0: 1
1: 1
2: 0
3: 22
4: 237
Right 978529950 4:109703097-109703119 CGGCGCCGGCGTCGCTACTCGGG 0: 1
1: 0
2: 0
3: 2
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978529942 Original CRISPR CCCCTGCCGCCTTTGTCCTC CGG (reversed) Intronic
900191293 1:1353390-1353412 CCCCTGCGGCCTTTGCTCACGGG - Intronic
900340204 1:2184900-2184922 CCCCTGCCACCTTTGCCCACAGG + Exonic
901054381 1:6441918-6441940 CCCCTGCAGCCTCTGGCCTCTGG - Intronic
902479935 1:16706418-16706440 CACCTGCAGCCTCTGGCCTCTGG + Intergenic
903368246 1:22818052-22818074 CCCCTGCCTTCTGTGTCATCTGG + Intronic
903647655 1:24904749-24904771 CCCCTCCAGCCTCTTTCCTCAGG + Intronic
904279541 1:29409287-29409309 GCCCTGCCTCCTTTGGCCCCTGG + Intergenic
904882043 1:33707753-33707775 CCCCTGGGGCATATGTCCTCTGG - Intronic
905407181 1:37741910-37741932 CTCCTCTCGCCTTTGTGCTCAGG - Intronic
905863774 1:41366173-41366195 CCTCCTCCTCCTTTGTCCTCCGG + Intronic
906180580 1:43815040-43815062 TCCCTGGGGCCTCTGTCCTCAGG + Intronic
909321055 1:74286332-74286354 CCCCTGTAGCCTGTGGCCTCAGG + Intronic
909470973 1:76027787-76027809 CCTCTGCCGCCTTTGTCCTCAGG - Intergenic
909526848 1:76634662-76634684 CCCATACCGCCTTTTCCCTCTGG - Intergenic
911867126 1:103042732-103042754 CCCTTGCCCCTTTAGTCCTCAGG + Intronic
912414018 1:109496004-109496026 GCTCTGCCTCCTTTGTCCCCGGG + Exonic
912501482 1:110125347-110125369 ACCCTGCAGCCATTGTCCTAAGG - Intergenic
915581642 1:156816474-156816496 ACCCTGTCACCTTTATCCTCAGG + Intronic
915915186 1:159936662-159936684 CCTTTGCCTCCTCTGTCCTCTGG + Intronic
916341898 1:163745657-163745679 CCCATGCCACCTTTGTCCACTGG + Intergenic
916723528 1:167503213-167503235 CCCCTGGGGCATTTGTCATCAGG + Intronic
918043375 1:180926701-180926723 CCCCTGCAGCCGTGGGCCTCTGG - Intronic
918311751 1:183290071-183290093 CCCCTTCCGCCCTTGCACTCTGG + Intronic
920504917 1:206508655-206508677 CCCCTCCTGCCTTTCACCTCTGG + Intronic
921667426 1:217889579-217889601 CCCCTACCGTCCCTGTCCTCTGG - Intergenic
922179488 1:223222961-223222983 CCACTGCTGCCTTTCTACTCTGG + Intronic
922523476 1:226278747-226278769 CCACTGCAGCCTCTGCCCTCTGG - Intronic
922757118 1:228102749-228102771 CCACTCCAGCCTTCGTCCTCAGG + Intronic
922851225 1:228735571-228735593 CCCTGGCCGCCTTTGTCTACTGG + Exonic
1063092070 10:2874096-2874118 CCACTGCCTCCTTTTTCCCCAGG - Intergenic
1064206606 10:13329721-13329743 CCACTGCCACCTGTGTCCCCAGG + Exonic
1066166682 10:32796070-32796092 CCTCTGTCTCCTCTGTCCTCAGG + Intronic
1067207637 10:44233455-44233477 ACCCTGCCGCCTTGGGGCTCAGG + Intergenic
1067317310 10:45180705-45180727 CACCTGCTGCCTTTGTCCCGGGG - Intergenic
1068519279 10:58061542-58061564 CCCCTGCCTTCTTTTTCTTCTGG + Intergenic
1069678225 10:70264766-70264788 TCCCTTCCGCCCCTGTCCTCTGG - Intronic
1071023348 10:81083648-81083670 CCCCTGCCCCTACTGTCCTCAGG - Intergenic
1073086774 10:100896110-100896132 CCCCAGCAGCCTTTGTCTTCAGG + Intergenic
1077337942 11:2013817-2013839 GCCCTGCCCGCTTTGTCCCCTGG + Intergenic
1077499750 11:2903793-2903815 ACCCGGCAGCCTTTGCCCTCTGG + Intronic
1081585280 11:44379972-44379994 CCCATGCCTGCTCTGTCCTCTGG + Intergenic
1084055440 11:66628986-66629008 CCCCTGCTGCCTCAGCCCTCAGG + Intronic
1084318177 11:68357874-68357896 CCCCTTTCCCCTTTGTCCCCAGG + Intronic
1084321085 11:68373679-68373701 CAGCTGCCGCCTTGGTCCTGGGG - Intronic
1084774764 11:71368115-71368137 CCCCTGCCCTCTCTGACCTCAGG + Intergenic
1087818568 11:102686223-102686245 CCCCTCCCTTCTTTGACCTCTGG - Intergenic
1088781611 11:113140215-113140237 ACCCTGCCTCCTGTGTCCTCAGG + Intronic
1089535253 11:119156993-119157015 CCCATGCCCTCCTTGTCCTCCGG + Exonic
1089912197 11:122112174-122112196 CCCCTGCCCCCTTTATTATCAGG - Intergenic
1091089392 11:132755993-132756015 CCCCTGTCTACTCTGTCCTCAGG + Intronic
1202820926 11_KI270721v1_random:68999-69021 GCCCTGCCCGCTTTGTCCCCTGG + Intergenic
1092975968 12:13745276-13745298 CCCAGGCAGCCTTTATCCTCTGG + Intronic
1101873301 12:108582651-108582673 TCCCTGCTGCCCTTGCCCTCAGG - Intergenic
1107417132 13:40211322-40211344 CCCTTCCCTCCTTTCTCCTCTGG - Intergenic
1109863754 13:68234481-68234503 CCCCTACTGTCTTTATCCTCTGG + Intergenic
1113588000 13:111478820-111478842 CCCCTTCTGCCCTTGCCCTCAGG - Intergenic
1114082963 14:19217868-19217890 CCCCTCCCGCCTTGCTCTTCTGG + Intergenic
1116131426 14:40859404-40859426 ACTCTGCCCTCTTTGTCCTCTGG - Intergenic
1116824404 14:49658049-49658071 TCCCTGCAGTCTCTGTCCTCTGG + Intronic
1117554462 14:56870212-56870234 CCCCTGCCTTCTCTCTCCTCTGG + Intergenic
1119650705 14:76381041-76381063 CCCCAGCAGCCTTAGACCTCTGG + Intronic
1119692816 14:76690462-76690484 CTCCTGCTGCCTTTGGCCTTTGG + Intergenic
1121674525 14:95741577-95741599 CACCTGCCACCTTTCTCCTTGGG + Intergenic
1121814885 14:96921599-96921621 CCCCTGCTGCCTTTCTCATAAGG + Intronic
1122023973 14:98861133-98861155 TCCCTGCCTCTTTTGTCTTCTGG - Intergenic
1122220788 14:100238407-100238429 CCCCTCCCTCCCTTCTCCTCAGG + Intronic
1122835104 14:104426975-104426997 TCCCTGCTGCCTCTGGCCTCTGG + Intergenic
1124623813 15:31296906-31296928 TCCCTGCTGCCTTTGTGCTCTGG - Intergenic
1124641402 15:31398637-31398659 TCCCAGCCACCTTTGTCCCCAGG + Intronic
1124937610 15:34187033-34187055 TCTCTGCCATCTTTGTCCTCTGG - Intronic
1125541097 15:40470746-40470768 CTCCTGCAGCGTGTGTCCTCAGG - Intergenic
1126252655 15:46587662-46587684 CCCCTGGCATCTCTGTCCTCAGG - Intergenic
1127418640 15:58782992-58783014 TCACTGCAGCCTTTGTCTTCTGG + Intronic
1127819633 15:62643727-62643749 CTCCTGATGCCTTTGACCTCTGG - Intronic
1128509413 15:68304116-68304138 CACTTGCTGCCTTTGGCCTCAGG + Intronic
1128877605 15:71215065-71215087 CCGCCGCCGCCGTCGTCCTCGGG - Exonic
1130803909 15:87298215-87298237 CCCCTGCTGACTTTGTCTTAGGG + Intergenic
1131060260 15:89400073-89400095 ACCCGGCCGCCTTTGTTCTCTGG + Intergenic
1131074450 15:89486453-89486475 TCCCTGCAGCCTTTGTCGTAGGG + Intronic
1131564317 15:93472159-93472181 CCCCTTCCGCTTCTGACCTCCGG - Intergenic
1132507432 16:318506-318528 GCCCGGCCGCCTGTGTCTTCAGG - Intronic
1135304112 16:21354380-21354402 CTCATGCAGGCTTTGTCCTCCGG + Intergenic
1136289496 16:29262824-29262846 CCCCTGCGGCACATGTCCTCAGG - Intergenic
1136300847 16:29333515-29333537 CTCATGCAGGCTTTGTCCTCCGG + Intergenic
1136854361 16:33642055-33642077 CCCCTGCCACATTTGTCCCTGGG - Intergenic
1137825323 16:51489724-51489746 TCTCTGCAGCCTGTGTCCTCAGG - Intergenic
1138242224 16:55436281-55436303 CCCCTCCCTCCTCTCTCCTCTGG - Intronic
1139949384 16:70661765-70661787 CCCCTGCCTCCTTTCCCATCAGG + Exonic
1140411203 16:74741533-74741555 CCCATGCCACCTCTGTCTTCTGG + Intronic
1141140224 16:81492627-81492649 CCCAAGGCGCCTTTGTCCCCAGG - Intronic
1142095235 16:88235804-88235826 CCCCTGCGGCACATGTCCTCAGG - Intergenic
1142142478 16:88478787-88478809 CCCCTGCCGCCCTTGCCTTGGGG - Intronic
1142428201 16:90011782-90011804 CCCCTGTCCCCTGTGCCCTCTGG - Intronic
1203115938 16_KI270728v1_random:1490505-1490527 CCCCTGCCACATTTGTCCCTGGG - Intergenic
1144872160 17:18378106-18378128 CCCCTGGGCCCTTTGTCCTCGGG - Intronic
1145013514 17:19382822-19382844 CCCCTGCCCCCTGTGTTCTCAGG + Exonic
1145255865 17:21322020-21322042 CCCCAGCAGCCTTCGTCCCCAGG - Intergenic
1145320756 17:21765926-21765948 CCCCAGCAGCCTTCGTCCCCAGG + Intergenic
1146017640 17:29246806-29246828 GCCCTGCGGCCTCTGGCCTCTGG - Intergenic
1148601510 17:48897856-48897878 CACCAGCCTCCTTTTTCCTCTGG - Intergenic
1148640394 17:49183438-49183460 TCCCTGCCCTCTTTGTCCTCTGG + Intergenic
1149607654 17:57936185-57936207 CCTCAGCCGCTTTTGTCCTTGGG - Intronic
1151420460 17:73993697-73993719 ACCCTGCCACCTCTGTCCCCAGG - Intergenic
1151756422 17:76077788-76077810 TCCCAGCCGCATTTGTGCTCTGG + Intronic
1155337423 18:24778950-24778972 CTTCTGCCACCTTTGGCCTCTGG - Intergenic
1158385850 18:56990793-56990815 CCCCTGCAGCCTCTGTGCTCAGG + Intronic
1159115293 18:64106520-64106542 CCCCTTCCTCCATTGTCATCTGG + Intergenic
1159309224 18:66686725-66686747 CCCCAGCCGCCGTTGCTCTCAGG + Intergenic
1161009082 19:1951490-1951512 GCCCAGCTGCCTGTGTCCTCTGG + Intronic
1161040965 19:2110589-2110611 CCCATGTCCCCTTTGTCCCCAGG - Intronic
1161550716 19:4910564-4910586 CCCGGGCCTCCTTTCTCCTCTGG + Intronic
1161596430 19:5153336-5153358 CCCCTGCTGCCCTTGTCCCTTGG + Exonic
1163729586 19:18941303-18941325 CCCCTGCCGGCTTTTTGCACTGG + Intergenic
1164010258 19:21196606-21196628 TCACTGCAGCCTCTGTCCTCTGG - Intergenic
1164434574 19:28218506-28218528 CCTCTGCCTCCACTGTCCTCAGG - Intergenic
1164690935 19:30210329-30210351 CCCCAAACTCCTTTGTCCTCAGG - Intergenic
1165632794 19:37316218-37316240 TCCCTGCCCGCTCTGTCCTCCGG + Intronic
1165682639 19:37790650-37790672 CCCGCGCCGCCTTCTTCCTCAGG - Intronic
1167033668 19:46979939-46979961 CCCCTGCTGCCTTCCTGCTCGGG - Intronic
1167478169 19:49712876-49712898 CCCCAGCCCCCTCTTTCCTCTGG - Intronic
1202713971 1_KI270714v1_random:32324-32346 CGCCTGCAGCCTCTGGCCTCTGG + Intergenic
924987866 2:288023-288045 CACCTGCCGGCTTGTTCCTCGGG - Exonic
927737084 2:25534136-25534158 TCCCTGCGGCCTTTGGCCTTCGG + Intronic
932374556 2:71224111-71224133 CCTCTGCTGTCTCTGTCCTCTGG - Intronic
932397830 2:71460270-71460292 CCCCGGCCCCCTTTCCCCTCTGG - Intronic
932467375 2:71932492-71932514 CCCCACCCGCCGTGGTCCTCAGG + Intergenic
932571008 2:72938404-72938426 CCCCTGCCTCCTTCCTCTTCAGG - Intergenic
934573486 2:95385874-95385896 CCCCTGCCGGCCTTGGCCTTGGG + Exonic
936944601 2:117919102-117919124 CTCCTGCTGCCCTGGTCCTCAGG - Exonic
938493615 2:131778769-131778791 CCCCTCCCGCCTTGCTCTTCTGG - Intergenic
944586691 2:201179077-201179099 TCTCTGCCCTCTTTGTCCTCTGG - Intergenic
945542320 2:211104326-211104348 CCCCTGCAGCCTCTCTCTTCTGG + Intergenic
945712413 2:213315302-213315324 ACCCTGCTGCCTCTGGCCTCAGG + Intronic
945920564 2:215750882-215750904 CCCCTGCCGCCTTTGCATTTGGG + Intergenic
946699463 2:222397189-222397211 CCTCTTCCTCCTTTGTCTTCAGG + Intergenic
947439810 2:230109479-230109501 CACCTGCCACCTTAGTCCTATGG + Intergenic
947988137 2:234466089-234466111 CTCCTTCCTCTTTTGTCCTCAGG - Intergenic
948725839 2:239933391-239933413 CGGCTGCAGCCTTTGTCCTCAGG - Intronic
948884242 2:240874967-240874989 CCCCAGCTGCATTTGTGCTCAGG - Intronic
1171167548 20:22985268-22985290 CCCCTCTCTTCTTTGTCCTCAGG - Intergenic
1172705652 20:36880436-36880458 CTCCTGCTGCCTTCCTCCTCTGG - Intronic
1173024828 20:39298233-39298255 CTCCTGCCATCTGTGTCCTCCGG - Intergenic
1175340866 20:58228363-58228385 CCCCTGACGTCTTCGTCCTGCGG - Exonic
1175552789 20:59827870-59827892 GCCCTGCCTCCTATGCCCTCAGG + Intronic
1175554061 20:59835341-59835363 CCCCTGGGGGCTTTGTCTTCTGG - Intronic
1175820387 20:61905991-61906013 CTCCAGCCGGCTTTGTTCTCAGG + Intronic
1176255683 20:64151545-64151567 CCCCTGTCTCCTTTGTCCACAGG + Intergenic
1177393747 21:20507879-20507901 CCCCTGCCACCACTGCCCTCAGG - Intergenic
1178703049 21:34850290-34850312 CGCCTGCTGCCTGTGTCCTTTGG - Intronic
1179400238 21:41076461-41076483 CCCGTGCCTCCTCTTTCCTCAGG + Intergenic
1180497816 22:15904813-15904835 CCCCTCCCGCCTTGCTCTTCTGG - Intergenic
1180859396 22:19068665-19068687 CCTCTGCAGCCCTTGTCCTGGGG + Intronic
1183077365 22:35435602-35435624 CTGCTGCAGCCTTTGTCCTGTGG + Intergenic
1183311050 22:37109647-37109669 CCCCTGTGGCCTGTGGCCTCAGG + Intergenic
1184104204 22:42358034-42358056 CACCTGCCTCCTCTGTCCGCTGG - Intergenic
1184104916 22:42361944-42361966 TCCCTGCCTCCTCTGCCCTCTGG - Intergenic
1184667690 22:45997315-45997337 CTCCTGCAGCCCTTGCCCTCGGG - Intergenic
950517945 3:13479825-13479847 GCCCTGCCGCCTGTGACCTAAGG - Intronic
950532024 3:13557764-13557786 TCACTGCAGCCTTTCTCCTCTGG - Intronic
950538866 3:13598076-13598098 ACCCTGCCTCCTCTTTCCTCTGG - Intronic
950578073 3:13844963-13844985 CAATTGCCGCCTTTGTCCTCGGG - Intronic
950615531 3:14155048-14155070 CCCCTGCTGCCTTTGACTGCTGG + Intronic
950869166 3:16213845-16213867 CCCCTTCTGCCCTGGTCCTCAGG + Intronic
952217173 3:31289046-31289068 GCCCTGCTGCCTTTGTGTTCAGG - Intergenic
952264532 3:31772619-31772641 CCCCTGCCGTCTCTATCCTCTGG + Intronic
952419697 3:33119820-33119842 CCCCTGCCCCTTTTGGCCTAGGG - Intronic
953096951 3:39787093-39787115 CCCCTCCCAACTTCGTCCTCAGG + Intergenic
953393161 3:42545564-42545586 CCCCTGCCCACTTTCCCCTCTGG + Intergenic
953824142 3:46235226-46235248 CCCCTGCCCCCTTTATTGTCTGG - Intronic
954386671 3:50247732-50247754 CCTCTGCAGCCTTTGCCCTGTGG - Intronic
959932791 3:112001267-112001289 CCCCTGCCTCCCTTCTCCTCTGG - Intronic
961983336 3:131104461-131104483 CCCCTGCCCCTGCTGTCCTCAGG - Intronic
963602659 3:147391447-147391469 TCCCTCCCGCCTTCCTCCTCTGG + Intronic
963667158 3:148202612-148202634 CCCCTTCCTCATTTGCCCTCTGG + Intergenic
966318973 3:178679710-178679732 GCCCTGTCCCCTTTGACCTCTGG + Intronic
966786786 3:183629742-183629764 CCCCTCCCTCCTTTCTTCTCTGG - Intergenic
968517696 4:1021759-1021781 CCCCTACTGCCCTTGTCCTTGGG + Intronic
969056030 4:4403372-4403394 TCCCTGCCGCTTCTGTCTTCTGG + Intronic
973792447 4:54390994-54391016 ACCCTTCCACCTTGGTCCTCAGG + Intergenic
974101179 4:57418877-57418899 CCCCTGCCTCCTTTAACTTCTGG - Intergenic
974199733 4:58622820-58622842 CCCCTGGCACCTCTGTCCTAGGG - Intergenic
977492409 4:97731876-97731898 CCTTTGGCCCCTTTGTCCTCTGG + Intronic
978529942 4:109703067-109703089 CCCCTGCCGCCTTTGTCCTCCGG - Intronic
982660044 4:158195788-158195810 CCCCTACAGCCTTTGTCTTCGGG + Intergenic
985546225 5:510474-510496 CCCCTGCCCACCTTGTCCCCTGG - Intronic
985626978 5:994150-994172 CCCCTCCCTCCTTTCTCCCCTGG - Intergenic
985746845 5:1652723-1652745 CCCCTGGACCCTTTGCCCTCAGG - Intergenic
990332741 5:54743797-54743819 CCATTGCTGCCTTTGTCATCAGG - Intergenic
990731758 5:58816363-58816385 CCCCAGCTCCCTTTCTCCTCAGG - Intronic
990797235 5:59557435-59557457 CCCCTGCCGCCATTGCCGACTGG + Intronic
991047511 5:62238126-62238148 CCCCTGCCACATTTGTCCCTCGG + Intergenic
996058100 5:119002206-119002228 CCCCTGTGATCTTTGTCCTCTGG - Intergenic
996543826 5:124656933-124656955 CCCCTGCAGCCTTTGTTCTGAGG + Intronic
997615940 5:135246280-135246302 TCTCTGCAGCCTTTCTCCTCTGG - Intronic
997819768 5:137054574-137054596 ACACTGACTCCTTTGTCCTCTGG - Intronic
998398639 5:141835976-141835998 CCCCTGCCTTATTTCTCCTCAGG + Intergenic
999312790 5:150562679-150562701 GCACTGCCACCTTTGTCCTGAGG + Intergenic
999666330 5:153917059-153917081 CCCCTGCCTGCTTTGTCCCTGGG - Intergenic
1002724730 5:181286891-181286913 GCCCTGTTGCATTTGTCCTCAGG + Intergenic
1003935133 6:10968355-10968377 CTCCTGGCCCCTTTGTCCACTGG - Intronic
1004492293 6:16128834-16128856 CACCAGCCGCCTCTGTCCGCTGG - Intergenic
1006154123 6:32005096-32005118 CCACTTCCTCCTTTGTCTTCTGG + Intergenic
1006160430 6:32037832-32037854 CCACTTCCTCCTTTGTCTTCTGG + Intergenic
1006770133 6:36546617-36546639 CCCTTACCGACTTTTTCCTCTGG + Intronic
1007633905 6:43286847-43286869 CCCCTGCAGCCTCTGTCCCCTGG + Exonic
1009946660 6:70348269-70348291 CCCTTGCTGCTTTTGCCCTCAGG - Intergenic
1013305275 6:108841815-108841837 CCCCTTCAGACTTTGTTCTCTGG + Intergenic
1013365389 6:109433797-109433819 CCCCTCCCTCCCTTCTCCTCTGG - Intronic
1014943813 6:127474509-127474531 CTCCTGCCCTCTTTGGCCTCTGG + Intronic
1019063088 6:169271238-169271260 TCCCTGCCGCCTTCCTGCTCTGG - Intergenic
1019112202 6:169724795-169724817 CCTCTCCCGCCTTTGTTCTCGGG + Intronic
1019296068 7:276159-276181 GCTCTGCCCTCTTTGTCCTCTGG + Intergenic
1019297463 7:285776-285798 CCCTTCCCGCCTCAGTCCTCGGG + Intergenic
1021561379 7:21971987-21972009 CCTCTGCTCTCTTTGTCCTCTGG + Intergenic
1022609575 7:31855514-31855536 CTCCTGCAACCTTTGTTCTCTGG - Intronic
1022864029 7:34398652-34398674 CCCCTTCCTCCTTTGCCCTAGGG - Intergenic
1025807853 7:64852732-64852754 CCACTGCCCCCTGTGTCCCCAGG + Intergenic
1027433993 7:78144885-78144907 CCCCTGCCCCCCATGTGCTCTGG + Intronic
1028686839 7:93599680-93599702 CAACTGCGGCCTTTATCCTCTGG + Intronic
1029664856 7:101988600-101988622 CTCCTGTCACCATTGTCCTCAGG + Intronic
1029702468 7:102256474-102256496 CCCCAGACGCCTTGGTTCTCTGG - Exonic
1033571696 7:142635765-142635787 CCACTGCAGCCTTTGTCTCCCGG - Intergenic
1033653912 7:143361329-143361351 CCCCTGTCTCCCTTCTCCTCAGG - Intronic
1033757165 7:144404570-144404592 CCGGTGCAGCCTTTGTGCTCTGG - Exonic
1034431053 7:151041284-151041306 GCCCTGCCCCCTTAGTCCTCAGG + Intronic
1034914230 7:155023591-155023613 CCCCAACCGCCTGTATCCTCAGG + Intergenic
1035311919 7:157974967-157974989 CTCCTGACGCCTGTGACCTCTGG + Intronic
1037397525 8:18458763-18458785 CCACTGCCTCCTTGTTCCTCAGG - Intergenic
1040021725 8:42746817-42746839 CCCCTGCCACCCCTGTCCTGTGG - Intergenic
1040564507 8:48553626-48553648 CCTCAGCCGCCTTCATCCTCGGG - Intergenic
1040850883 8:51899249-51899271 CCCCTACCGCCATCGTCTTCTGG - Intergenic
1041088449 8:54279589-54279611 CTCCTGCCGTCTCTGCCCTCTGG + Intergenic
1045592557 8:103614056-103614078 CACATGCCTCCTTAGTCCTCTGG + Intronic
1047136333 8:122082803-122082825 CCCCTGCCTACTGTGTACTCAGG + Intergenic
1047755024 8:127911825-127911847 TCCCTGCTCCCTTTGGCCTCAGG + Intergenic
1049277646 8:141727904-141727926 CCCCTCCCGCCTGTGTTCTCCGG - Intergenic
1053076647 9:35139428-35139450 TCTCTGCCCTCTTTGTCCTCTGG - Intergenic
1053616136 9:39768349-39768371 CCCCTGCTGCTTTTGTTTTCTGG - Intergenic
1053874307 9:42527650-42527672 CCCCTGCTGCTTTTGTTTTCTGG - Intergenic
1053898308 9:42766932-42766954 CCCCTGCTGCTTTTGTTTTCTGG + Intergenic
1054237381 9:62574041-62574063 CCCCTGCTGCTTTTGTTTTCTGG + Intergenic
1054551516 9:66608552-66608574 CCCCTGCTGCTTTTGTTTTCTGG + Intergenic
1056721096 9:89072771-89072793 CCCCTTGGGCCCTTGTCCTCGGG + Intronic
1057568858 9:96188501-96188523 GCCATCCTGCCTTTGTCCTCAGG + Intergenic
1057937880 9:99256273-99256295 CCCCTCCTACCTCTGTCCTCTGG + Intergenic
1060553109 9:124494981-124495003 TCCCTGGGGCCTGTGTCCTCAGG + Intronic
1060661106 9:125405684-125405706 GCCCTGGCCCCTTTGTCCCCAGG - Intergenic
1061009858 9:127948476-127948498 CCCCTGCAGCCTTTCGGCTCTGG + Intronic
1061231273 9:129317280-129317302 CCCCTGCAGCCTTGATCTTCCGG + Intergenic
1061868368 9:133506980-133507002 CCCCTGCAGCCTTTGTACGACGG - Intergenic
1062169246 9:135125624-135125646 CCCCTGGACCCTTTGTCCTGGGG + Intergenic
1188004125 X:25005656-25005678 CCCCTGTAGCCTCTGGCCTCAGG + Intronic
1189360216 X:40344095-40344117 TCTCTGCCTTCTTTGTCCTCTGG - Intergenic
1189823282 X:44891682-44891704 ACCCTGCCTCCTTTGTTCTGTGG - Intronic
1190300449 X:49054038-49054060 CCCCTGCTGGCCTTGGCCTCAGG + Intronic
1192200506 X:69063609-69063631 CCCATGGCCCCTGTGTCCTCTGG - Intergenic
1192727768 X:73769853-73769875 CCACTGCCACCTGTGTCCCCAGG - Intergenic
1193496435 X:82219303-82219325 CCCCTGCTGCCTTTGCTCTGAGG - Intergenic
1193919340 X:87406749-87406771 TCTCTGCCCTCTTTGTCCTCTGG + Intergenic
1194379378 X:93175265-93175287 TCTCTGCCCTCTTTGTCCTCTGG - Intergenic
1200229744 X:154437904-154437926 CATCTGCAGCCTTTGTCCTTGGG + Intronic