ID: 978529946

View in Genome Browser
Species Human (GRCh38)
Location 4:109703094-109703116
Sequence GAGTAGCGACGCCGGCGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 43}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978529946_978529955 3 Left 978529946 4:109703094-109703116 CCCCGGCGCCGGCGTCGCTACTC 0: 1
1: 0
2: 0
3: 1
4: 43
Right 978529955 4:109703120-109703142 ACCGCCAGGAGGCGGCAGCCAGG 0: 1
1: 0
2: 0
3: 26
4: 244
978529946_978529953 -8 Left 978529946 4:109703094-109703116 CCCCGGCGCCGGCGTCGCTACTC 0: 1
1: 0
2: 0
3: 1
4: 43
Right 978529953 4:109703109-109703131 CGCTACTCGGGACCGCCAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 60
978529946_978529954 -5 Left 978529946 4:109703094-109703116 CCCCGGCGCCGGCGTCGCTACTC 0: 1
1: 0
2: 0
3: 1
4: 43
Right 978529954 4:109703112-109703134 TACTCGGGACCGCCAGGAGGCGG 0: 1
1: 0
2: 1
3: 5
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978529946 Original CRISPR GAGTAGCGACGCCGGCGCCG GGG (reversed) Intronic
903510082 1:23868272-23868294 GGGTAGCGATGCGGGCTCCGGGG - Exonic
908028692 1:59976944-59976966 GAGTAACGAAGCCGGCACAGGGG + Intergenic
919847015 1:201648713-201648735 GAGCAGCGGCGGCGGCGACGAGG + Exonic
920260538 1:204685270-204685292 GGGCAGCGCCGCCGCCGCCGGGG - Intronic
920352168 1:205344302-205344324 GAGAAGCGGAGCCGCCGCCGGGG + Exonic
1065298368 10:24298508-24298530 GAGTAGCGAGCCGGGCGCAGTGG + Intronic
1072591470 10:96832202-96832224 GAGGCGCGACGCCCGGGCCGCGG + Intergenic
1077018098 11:405834-405856 GAGGAGCGACGCCGCTGCCCTGG + Exonic
1097676068 12:62603467-62603489 GAGAGGCGGCGCCGGCGCCCGGG - Exonic
1100260556 12:92928962-92928984 GAGGAGGGGCGCCCGCGCCGCGG + Intronic
1108389645 13:49936014-49936036 GCGCAGCGTCGCCGGCGCGGCGG + Intronic
1110596556 13:77326662-77326684 GAACAGCGCCCCCGGCGCCGGGG + Exonic
1111975959 13:94967792-94967814 GACTCGGGGCGCCGGCGCCGGGG + Intergenic
1125728860 15:41881939-41881961 GAATAACGACGCCCGGGCCGAGG + Exonic
1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG + Exonic
1135747778 16:25031931-25031953 GAATTGCGACGCGGGCGACGAGG + Intergenic
1139590365 16:67929732-67929754 GAGTAGCCATGCCGAGGCCGGGG - Exonic
1143053076 17:4142772-4142794 GAGCCGCGACGCCCGGGCCGGGG + Exonic
1143099879 17:4499111-4499133 GAGCGGCGGCGCCGGCGCCGGGG + Exonic
1146955858 17:36936115-36936137 GAGGCGCGGCGCCGGCGCGGGGG - Intergenic
1151802070 17:76384583-76384605 GCGGAGCCAGGCCGGCGCCGAGG + Intronic
1152675293 17:81637017-81637039 GCGTAGGGAGGCCGGGGCCGGGG - Exonic
1152728741 17:81959955-81959977 GAGGACCGCCGCCCGCGCCGAGG - Intronic
1165349932 19:35269765-35269787 GAGCGGCGAGGCCGGCGCTGGGG - Intronic
937931084 2:127205658-127205680 GAGGGGCGACGCTGGCTCCGTGG - Exonic
941580725 2:167293209-167293231 GAGAAGTGATGCTGGCGCCGGGG + Intergenic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
948946736 2:241224299-241224321 GAGGAGAGAAGCCGGCGCTGGGG - Exonic
1172698078 20:36835851-36835873 GAGCAGCGGCGGCGGCGGCGGGG - Intronic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1176029798 20:63006476-63006498 GAGCAGCGGCGGCGGCGGCGCGG - Exonic
1180733872 22:18001415-18001437 CCACAGCGACGCCGGCGCCGAGG - Intronic
954778999 3:53045747-53045769 GAGGGGCGGCGGCGGCGCCGGGG - Intronic
955818776 3:62874801-62874823 GAGCAGCGGCGGCGGGGCCGGGG - Exonic
971327468 4:25655893-25655915 GAGTACCGCCGCCGGGGCAGGGG + Intronic
978072626 4:104491565-104491587 CAGCAGCGCCGCCGCCGCCGCGG - Exonic
978529946 4:109703094-109703116 GAGTAGCGACGCCGGCGCCGGGG - Intronic
998374516 5:141682065-141682087 GGGGAGGGCCGCCGGCGCCGAGG + Intronic
1006318551 6:33305222-33305244 GAGTGGCGACGCCAGCACCTGGG - Exonic
1008932467 6:56954927-56954949 GAGGAGCAGCGCCGCCGCCGCGG + Intergenic
1011195323 6:84774337-84774359 GAGTCGGGGCGCGGGCGCCGCGG - Intergenic
1020238469 7:6374470-6374492 GAGCGGCGGCGCCGGCGCGGGGG + Intergenic
1024628547 7:51229275-51229297 GAGTACAGGCGCCGGCACCGCGG - Intronic
1058153323 9:101486126-101486148 CACTAGCGACGCCGGAGCCAAGG + Intronic
1189321507 X:40090271-40090293 GAGGGGAGACGGCGGCGCCGGGG + Intronic