ID: 978529947

View in Genome Browser
Species Human (GRCh38)
Location 4:109703095-109703117
Sequence CGAGTAGCGACGCCGGCGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 41}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978529947_978529954 -6 Left 978529947 4:109703095-109703117 CCCGGCGCCGGCGTCGCTACTCG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 978529954 4:109703112-109703134 TACTCGGGACCGCCAGGAGGCGG 0: 1
1: 0
2: 1
3: 5
4: 79
978529947_978529955 2 Left 978529947 4:109703095-109703117 CCCGGCGCCGGCGTCGCTACTCG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 978529955 4:109703120-109703142 ACCGCCAGGAGGCGGCAGCCAGG 0: 1
1: 0
2: 0
3: 26
4: 244
978529947_978529953 -9 Left 978529947 4:109703095-109703117 CCCGGCGCCGGCGTCGCTACTCG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 978529953 4:109703109-109703131 CGCTACTCGGGACCGCCAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978529947 Original CRISPR CGAGTAGCGACGCCGGCGCC GGG (reversed) Intronic
901050663 1:6424482-6424504 GGAATTGCGTCGCCGGCGCCTGG + Intronic
903501210 1:23800954-23800976 CGAGAGGCGCCGCCGGCGCCAGG + Intergenic
914243895 1:145872122-145872144 CGAGGAGCGCCGCCGGAGCGGGG - Exonic
920394226 1:205632001-205632023 CGTGTAGCGACTACGGCGTCTGG - Intergenic
922373031 1:224930026-224930048 GGCGTGGCGGCGCCGGCGCCTGG - Intronic
1066442226 10:35449665-35449687 CGAGTAGGGGGGCCGGCCCCAGG + Intronic
1071676453 10:87660017-87660039 CGGGGAGGGAAGCCGGCGCCTGG - Intronic
1078180186 11:9004404-9004426 CGAGCAGCGGCGCGGGCGGCGGG - Intergenic
1084175605 11:67420800-67420822 CGAGCAGCGCGGCGGGCGCCGGG + Exonic
1090978387 11:131695027-131695049 GGAGGAGCGCCGCCGCCGCCGGG + Intronic
1097676069 12:62603468-62603490 TGAGAGGCGGCGCCGGCGCCCGG - Exonic
1101144721 12:101830535-101830557 TGAGTAGCGGCGCCGCAGCCTGG - Intronic
1103308956 12:119989506-119989528 CGAGGAGGAACGCCGCCGCCGGG - Intergenic
1111951339 13:94711656-94711678 CGAGCAGCGACTCAGGCACCAGG + Exonic
1121751648 14:96363033-96363055 GGGGTAGCGACTCCGGCTCCAGG + Exonic
1122542719 14:102507052-102507074 CGAAGAGCGAGGGCGGCGCCAGG + Exonic
1129541089 15:76347303-76347325 CGCGTGGCGACTCCGCCGCCGGG - Intergenic
1143099878 17:4499110-4499132 GGAGCGGCGGCGCCGGCGCCGGG + Exonic
1146283270 17:31558995-31559017 CGAGTAGGGCCGCCCGCGTCGGG + Intergenic
1150373637 17:64662321-64662343 CGAGTGGCGGCGGCGGCCCCAGG - Intergenic
1151660722 17:75516665-75516687 CGGGTAGGGAAACCGGCGCCCGG + Intronic
1161401389 19:4067371-4067393 CGAGGAGCGACGCGGGCGTGTGG + Intergenic
1163807038 19:19405776-19405798 CGGGCGGTGACGCCGGCGCCGGG + Intronic
1163847944 19:19647700-19647722 CGAGCGGCGACGGCGGCCCCGGG - Exonic
1166838432 19:45681785-45681807 CGAGGAGCAACGCCAGCTCCCGG + Exonic
1167377309 19:49119081-49119103 CGAGTCGCGACCCCGGCTCCCGG - Exonic
926251095 2:11155790-11155812 CCAGCTGCGACGCCGGCGCGCGG - Intronic
935237561 2:101151329-101151351 CGAGAGGCGACGGCGGCGCGCGG + Intronic
936412950 2:112276219-112276241 CGAGCAGCGACCCCGGCTCGGGG - Intronic
946397032 2:219448379-219448401 CGAGGAGCGACGGCGCAGCCTGG + Exonic
1173453949 20:43189272-43189294 CGAGGAGCGGCACCGACGCCCGG - Intronic
1183601807 22:38844191-38844213 CGAGGAGCGAGGGCAGCGCCTGG + Intergenic
950730107 3:14948627-14948649 CGGGTGGAGAGGCCGGCGCCTGG + Intronic
953947664 3:47163632-47163654 CGAGCAGCGGCGCCAACGCCGGG + Intronic
955818777 3:62874802-62874824 CGAGCAGCGGCGGCGGGGCCGGG - Exonic
978529947 4:109703095-109703117 CGAGTAGCGACGCCGGCGCCGGG - Intronic
1006318552 6:33305223-33305245 AGAGTGGCGACGCCAGCACCTGG - Exonic
1006496177 6:34425255-34425277 TGAGTAACGAGGCCGGGGCCCGG + Intronic
1006547621 6:34792517-34792539 AGACTAGCGGCACCGGCGCCAGG - Intronic
1011516982 6:88166030-88166052 CGGGAGGCGGCGCCGGCGCCGGG + Exonic
1019057125 6:169231906-169231928 CGCGTAGCGTCCCCGGCGCCAGG + Intronic
1023951239 7:44847889-44847911 CAGGTAGCGGCGCCGACGCCAGG + Intronic
1038311476 8:26449274-26449296 CGAGCGGTTACGCCGGCGCCAGG + Intronic
1041502409 8:58553321-58553343 CAAGGAGGGACGCCGGTGCCAGG + Intronic
1196842632 X:119872234-119872256 AGAGTAGCGACGCGGGGGCCGGG + Intronic
1200216666 X:154371175-154371197 CGCGTGTCGACGCCGCCGCCCGG + Exonic