ID: 978529948

View in Genome Browser
Species Human (GRCh38)
Location 4:109703096-109703118
Sequence CCGAGTAGCGACGCCGGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 33}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978529948_978529954 -7 Left 978529948 4:109703096-109703118 CCGGCGCCGGCGTCGCTACTCGG 0: 1
1: 0
2: 0
3: 4
4: 33
Right 978529954 4:109703112-109703134 TACTCGGGACCGCCAGGAGGCGG 0: 1
1: 0
2: 1
3: 5
4: 79
978529948_978529953 -10 Left 978529948 4:109703096-109703118 CCGGCGCCGGCGTCGCTACTCGG 0: 1
1: 0
2: 0
3: 4
4: 33
Right 978529953 4:109703109-109703131 CGCTACTCGGGACCGCCAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 60
978529948_978529955 1 Left 978529948 4:109703096-109703118 CCGGCGCCGGCGTCGCTACTCGG 0: 1
1: 0
2: 0
3: 4
4: 33
Right 978529955 4:109703120-109703142 ACCGCCAGGAGGCGGCAGCCAGG 0: 1
1: 0
2: 0
3: 26
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978529948 Original CRISPR CCGAGTAGCGACGCCGGCGC CGG (reversed) Intronic
900497710 1:2983592-2983614 CCGAGTGCCGACTCCGGCTCTGG - Intergenic
903455431 1:23484010-23484032 CCGAGGGGCGGCGCTGGCGCGGG - Exonic
907303106 1:53500472-53500494 GCAAGTAGAGATGCCGGCGCTGG - Intergenic
914243896 1:145872123-145872145 CCGAGGAGCGCCGCCGGAGCGGG - Exonic
1070481990 10:76891650-76891672 CGGAGGAGCCACGCCGGAGCTGG - Exonic
1078180187 11:9004405-9004427 CCGAGCAGCGGCGCGGGCGGCGG - Intergenic
1082928991 11:58579502-58579524 CCGAGTATCCCCGCCGGCGGAGG + Exonic
1084175604 11:67420799-67420821 CCGAGCAGCGCGGCGGGCGCCGG + Exonic
1088613562 11:111602186-111602208 CCGAGCAGCGACCCCGCCCCTGG + Intergenic
1089452659 11:118608444-118608466 CTGGGTAGGGGCGCCGGCGCAGG + Intronic
1103485362 12:121279251-121279273 CCGGGCAGGGACGTCGGCGCTGG + Intronic
1124014283 15:25862935-25862957 GCGAGCGGCGACGGCGGCGCGGG - Exonic
1128992555 15:72272767-72272789 CCGACTAGCGACCGCCGCGCAGG - Intronic
1137988715 16:53131319-53131341 CCGAGCAGCGGCGGCGGCGGCGG - Intronic
1143099877 17:4499109-4499131 CGGAGCGGCGGCGCCGGCGCCGG + Exonic
1143584189 17:7843258-7843280 CCGAGTACCGAGGCAGGGGCGGG - Intronic
1146955860 17:36936117-36936139 CGGAGGCGCGGCGCCGGCGCGGG - Intergenic
1154231446 18:12559350-12559372 CCGGCTGGCGACGCCGGCCCGGG - Intronic
1155075206 18:22348601-22348623 GCGCGCAGCGACGCCGGCCCGGG + Intergenic
1162572469 19:11481090-11481112 CCAATGAGCGACGCCGGCGCTGG - Intronic
1163443798 19:17334786-17334808 GCGAGGACCGAGGCCGGCGCGGG - Exonic
1163807037 19:19405775-19405797 CCGGGCGGTGACGCCGGCGCCGG + Intronic
1165349934 19:35269767-35269789 CAGAGCGGCGAGGCCGGCGCTGG - Intronic
1166536078 19:43575605-43575627 CGCAGTGTCGACGCCGGCGCCGG - Exonic
936412951 2:112276220-112276242 GCGAGCAGCGACCCCGGCTCGGG - Intronic
945492836 2:210476461-210476483 CCGAGTTGCGAGGGCGGCGGCGG + Exonic
948828719 2:240586923-240586945 CCGGGGCGCGACGCCGGCGAGGG + Exonic
948946738 2:241224301-241224323 CTGAGGAGAGAAGCCGGCGCTGG - Exonic
1184820035 22:46903319-46903341 CCGAGTACAGACGCCCCCGCAGG - Intronic
953484952 3:43286527-43286549 CCGGGTAGCTGCGCCTGCGCGGG - Exonic
978529948 4:109703096-109703118 CCGAGTAGCGACGCCGGCGCCGG - Intronic
998130374 5:139648678-139648700 CCGAGTCGCGCCGCCGCGGCTGG - Exonic
999753364 5:154646833-154646855 CCGAGGAGCGACGGCGGCGGGGG - Intergenic
1034781842 7:153888137-153888159 CGGAGCACCGAGGCCGGCGCGGG - Intronic
1045971322 8:108082704-108082726 CCCAGCAGCGCGGCCGGCGCCGG - Exonic
1196735044 X:118975498-118975520 CGGAGTTGCGACGCTCGCGCTGG - Exonic
1196842631 X:119872233-119872255 CAGAGTAGCGACGCGGGGGCCGG + Intronic
1197203041 X:123765250-123765272 CCGAGTGGCGGCGGCGGCGGCGG - Intergenic