ID: 978529953

View in Genome Browser
Species Human (GRCh38)
Location 4:109703109-109703131
Sequence CGCTACTCGGGACCGCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 60}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978529940_978529953 20 Left 978529940 4:109703066-109703088 CCCGGAGGACAAAGGCGGCAGGG 0: 1
1: 1
2: 4
3: 29
4: 365
Right 978529953 4:109703109-109703131 CGCTACTCGGGACCGCCAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 60
978529947_978529953 -9 Left 978529947 4:109703095-109703117 CCCGGCGCCGGCGTCGCTACTCG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 978529953 4:109703109-109703131 CGCTACTCGGGACCGCCAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 60
978529942_978529953 19 Left 978529942 4:109703067-109703089 CCGGAGGACAAAGGCGGCAGGGG 0: 1
1: 1
2: 0
3: 22
4: 237
Right 978529953 4:109703109-109703131 CGCTACTCGGGACCGCCAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 60
978529948_978529953 -10 Left 978529948 4:109703096-109703118 CCGGCGCCGGCGTCGCTACTCGG 0: 1
1: 0
2: 0
3: 4
4: 33
Right 978529953 4:109703109-109703131 CGCTACTCGGGACCGCCAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 60
978529946_978529953 -8 Left 978529946 4:109703094-109703116 CCCCGGCGCCGGCGTCGCTACTC 0: 1
1: 0
2: 0
3: 1
4: 43
Right 978529953 4:109703109-109703131 CGCTACTCGGGACCGCCAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 60
978529938_978529953 21 Left 978529938 4:109703065-109703087 CCCCGGAGGACAAAGGCGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 146
Right 978529953 4:109703109-109703131 CGCTACTCGGGACCGCCAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978529953 Original CRISPR CGCTACTCGGGACCGCCAGG AGG Intronic
900174729 1:1286652-1286674 CCCTACTCGGGACGCCCAGTGGG - Intronic
915393395 1:155563377-155563399 CGGGACTCCGGACCTCCAGGAGG + Intergenic
915409518 1:155689222-155689244 CGGGACTCCGGACCTCCAGGAGG + Intronic
1064964949 10:21005619-21005641 CGCTACTCGGGAGGCTCAGGTGG + Intronic
1066563152 10:36691990-36692012 TGCGACTGGGGACCACCAGGAGG - Intergenic
1070329135 10:75405495-75405517 CGCTCCCAGGGACCGCGAGGCGG - Intergenic
1075131264 10:119741931-119741953 AGCTACTTGGGAGCACCAGGTGG - Intronic
1077106055 11:843111-843133 CACTACTCGGCGCGGCCAGGAGG - Intronic
1077976264 11:7251859-7251881 CGCTACTCGCGGCCGCCGGGGGG - Intronic
1083821509 11:65173778-65173800 AGCTACTCGGGACGCCAAGGTGG + Intergenic
1088812298 11:113399958-113399980 TGCTCCTCTGGACCGCCAGGTGG - Exonic
1096479349 12:51927883-51927905 AGCTACTCGGGAGGCCCAGGTGG - Intergenic
1101719934 12:107342371-107342393 AGCTACTCTGGACAGCCAGAGGG - Intronic
1114069729 14:19097558-19097580 TGCGACTCGGGACCCCCAGCCGG - Intergenic
1114092532 14:19302445-19302467 TGCGACTCGGGACCCCCAGCCGG + Intergenic
1114735941 14:25044056-25044078 AGCTACTCGGGAACCCAAGGTGG + Intronic
1115544890 14:34456784-34456806 AGCTACTCGGGAGGGCAAGGCGG + Intronic
1121198157 14:92094053-92094075 AGCTACTCGGGAGCCTCAGGAGG - Intronic
1123132619 14:106000316-106000338 GGGCACTCGGAACCGCCAGGGGG - Intergenic
1123582837 15:21731447-21731469 GGGCACTCGGAACCGCCAGGGGG - Intergenic
1123619487 15:22174043-22174065 GGGCACTCGGAACCGCCAGGGGG - Intergenic
1125619248 15:41045001-41045023 CGCTCCTGGGGAGCGCCAGAAGG - Exonic
1132183013 15:99776471-99776493 CGCTACTCGGGAGGCCGAGGCGG - Intergenic
1132768745 16:1549007-1549029 CGCTGCTGGAGAGCGCCAGGTGG - Intronic
1132879538 16:2155893-2155915 CGCGCCTCGGGACCGCGCGGTGG + Intronic
1139849283 16:69940935-69940957 CGCCACTGGGGACTGCCTGGGGG - Exonic
1141435473 16:83997364-83997386 CCCTGCTTGGGACCACCAGGAGG + Intronic
1143900089 17:10167809-10167831 AGCTACTCGGGAGGCCCAGGTGG - Intronic
1151350259 17:73527671-73527693 CGCTCCTCTGCACTGCCAGGAGG - Intronic
1152724728 17:81939572-81939594 CGCTAGGAGGGGCCGCCAGGAGG + Intronic
1154173523 18:12067522-12067544 AGCTACACGGGACCCCCAGGAGG - Intergenic
1156267818 18:35504139-35504161 TGCCACTCGGCACTGCCAGGAGG - Intergenic
1160877833 19:1305438-1305460 AGCTACTCGGGAGGCCCAGGGGG + Intergenic
1161959505 19:7516109-7516131 CGCTCCCCGGGAGCGCCTGGCGG + Exonic
1167877923 19:52429706-52429728 AGCTACTCGGGAGGCCCAGGCGG - Intronic
1168267410 19:55230387-55230409 CTCTCCTCTGGACCCCCAGGAGG - Exonic
925967178 2:9076911-9076933 AGCTACTCGGGACGCCGAGGTGG + Intergenic
927148636 2:20183208-20183230 AGCTACTGGGGACCCCCAGAAGG + Intergenic
928572963 2:32627211-32627233 AGCTACTCGGGACGGTGAGGCGG - Intergenic
931253309 2:60551521-60551543 CACAGCTCGGGACCGCGAGGAGG - Intronic
932476352 2:72008764-72008786 CACTGCTCGGGAGCACCAGGAGG + Intergenic
935790011 2:106582258-106582280 CGCTGCTCGCGGCCGGCAGGAGG + Intergenic
939232079 2:139441044-139441066 AGCTACTCGGGAGGCCCAGGTGG - Intergenic
1172037260 20:32018999-32019021 CGCGACCCCGGCCCGCCAGGCGG + Exonic
1175858195 20:62133929-62133951 AGCGCCTCGGGACAGCCAGGTGG + Intronic
1179776028 21:43663376-43663398 CGCTACTCGGGAGGGTGAGGCGG - Intronic
1180488197 22:15820121-15820143 TGCGACTCGGGACCCCCAGCCGG - Intergenic
1181153375 22:20901242-20901264 AGCTACTCAGGAGCCCCAGGTGG + Intergenic
1183082504 22:35465481-35465503 TGCTACTCAGGACCGCAGGGAGG - Intergenic
1185061736 22:48610554-48610576 GGCAGCTCGGGACCACCAGGAGG + Intronic
978529953 4:109703109-109703131 CGCTACTCGGGACCGCCAGGAGG + Intronic
983523985 4:168741570-168741592 AGCTACTCGGGACAGTGAGGTGG + Intronic
985645822 5:1084316-1084338 CACTACTCGGCACCGCGCGGTGG - Intronic
990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG + Exonic
992959913 5:81947855-81947877 AGCTACTTGGGACGGCGAGGTGG + Intergenic
1006193290 6:32222483-32222505 CGCTGCTGGGGGCAGCCAGGAGG - Intronic
1006812381 6:36828205-36828227 AGCTACTCGGGACTCCAAGGAGG + Intronic
1010409287 6:75542837-75542859 AGCTACTCGGGACGGCAAGGAGG + Intergenic
1017159264 6:151350047-151350069 CGATTCTCCGGACAGCCAGGAGG + Exonic
1029524607 7:101087339-101087361 CGCTGCTCAGGGCCTCCAGGAGG - Exonic
1035025620 7:155823460-155823482 CGCTGCTCGGGAGGGGCAGGGGG - Intergenic
1037969701 8:23163551-23163573 CGCCGCACGGGACAGCCAGGGGG + Intronic
1049681396 8:143920154-143920176 GGCTGCTCGGGCCCGGCAGGAGG - Exonic
1062261646 9:135665915-135665937 TGCGACTCGGGACGGGCAGGGGG + Intronic
1189309493 X:40009572-40009594 CTCCGCTCGGGACCGGCAGGAGG + Intergenic