ID: 978529954

View in Genome Browser
Species Human (GRCh38)
Location 4:109703112-109703134
Sequence TACTCGGGACCGCCAGGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 79}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978529942_978529954 22 Left 978529942 4:109703067-109703089 CCGGAGGACAAAGGCGGCAGGGG 0: 1
1: 1
2: 0
3: 22
4: 237
Right 978529954 4:109703112-109703134 TACTCGGGACCGCCAGGAGGCGG 0: 1
1: 0
2: 1
3: 5
4: 79
978529946_978529954 -5 Left 978529946 4:109703094-109703116 CCCCGGCGCCGGCGTCGCTACTC 0: 1
1: 0
2: 0
3: 1
4: 43
Right 978529954 4:109703112-109703134 TACTCGGGACCGCCAGGAGGCGG 0: 1
1: 0
2: 1
3: 5
4: 79
978529940_978529954 23 Left 978529940 4:109703066-109703088 CCCGGAGGACAAAGGCGGCAGGG 0: 1
1: 1
2: 4
3: 29
4: 365
Right 978529954 4:109703112-109703134 TACTCGGGACCGCCAGGAGGCGG 0: 1
1: 0
2: 1
3: 5
4: 79
978529948_978529954 -7 Left 978529948 4:109703096-109703118 CCGGCGCCGGCGTCGCTACTCGG 0: 1
1: 0
2: 0
3: 4
4: 33
Right 978529954 4:109703112-109703134 TACTCGGGACCGCCAGGAGGCGG 0: 1
1: 0
2: 1
3: 5
4: 79
978529938_978529954 24 Left 978529938 4:109703065-109703087 CCCCGGAGGACAAAGGCGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 146
Right 978529954 4:109703112-109703134 TACTCGGGACCGCCAGGAGGCGG 0: 1
1: 0
2: 1
3: 5
4: 79
978529947_978529954 -6 Left 978529947 4:109703095-109703117 CCCGGCGCCGGCGTCGCTACTCG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 978529954 4:109703112-109703134 TACTCGGGACCGCCAGGAGGCGG 0: 1
1: 0
2: 1
3: 5
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978529954 Original CRISPR TACTCGGGACCGCCAGGAGG CGG Intronic
901768533 1:11518986-11519008 TACTCAGGGGAGCCAGGAGGAGG - Intronic
905602732 1:39268292-39268314 AACTAGGGAGGGCCAGGAGGAGG - Intronic
909798096 1:79769530-79769552 TATTCGGGACCACCAAGTGGAGG + Intergenic
914673341 1:149888582-149888604 TCCTCTTGACCTCCAGGAGGCGG + Intronic
918550206 1:185733970-185733992 AACTCGGCCCAGCCAGGAGGGGG - Intergenic
1064143961 10:12812757-12812779 TACACTGGACGGCCAGGAAGAGG - Intronic
1075021598 10:118956443-118956465 TGCTGGGGACCTCCAGGAGATGG + Intergenic
1077148940 11:1059894-1059916 GACCTGGGACTGCCAGGAGGTGG + Intergenic
1077148953 11:1059941-1059963 GACCTGGGACTGCCAGGAGGTGG + Intergenic
1077976263 11:7251856-7251878 TACTCGCGGCCGCCGGGGGGCGG - Intronic
1081715400 11:45246431-45246453 TAATCAGCACCACCAGGAGGCGG + Exonic
1085318827 11:75562187-75562209 TTCTCGGGACGGGCAGGAGGGGG + Intronic
1088812297 11:113399955-113399977 TCCTCTGGACCGCCAGGTGGAGG - Exonic
1097099077 12:56573558-56573580 TACACGGGATTGCCAGCAGGTGG - Intronic
1098581770 12:72108060-72108082 TGCTAGGGACAGCCAGGAGAAGG + Intronic
1105204730 13:18211448-18211470 CACTAGGGACTGCTAGGAGGGGG + Intergenic
1114269557 14:21092497-21092519 TCCTCGGGAGCGGCAGGAGCTGG + Exonic
1119756739 14:77125111-77125133 GGCTCGGGCCCGCCGGGAGGGGG - Intronic
1129145054 15:73639506-73639528 TTCTCTAGACCTCCAGGAGGAGG + Intergenic
1134134036 16:11668300-11668322 TGCTCGGGGCCGGCAGGCGGTGG - Intergenic
1135889724 16:26346252-26346274 TAGTCAGACCCGCCAGGAGGAGG - Intergenic
1141575219 16:84959184-84959206 TACCAGGGACTGCCAGCAGGAGG - Intergenic
1143993941 17:10990682-10990704 TCCTGGGGACCCCCAGGAAGGGG - Intergenic
1146617236 17:34366694-34366716 CACTCGGGCCATCCAGGAGGAGG - Intergenic
1147757802 17:42780221-42780243 TACTCCGGACAGTTAGGAGGGGG + Intergenic
1148747025 17:49924250-49924272 TCCTGGGGACCGCCTGGAGCTGG - Intergenic
1149246234 17:54711747-54711769 TACTGGGGCCTGTCAGGAGGTGG + Intergenic
1150911146 17:69388927-69388949 TACTCCGGATAGCCAAGAGGTGG - Intergenic
1151675600 17:75595840-75595862 GCCTCAGGACAGCCAGGAGGGGG + Intergenic
1151732194 17:75918090-75918112 TCCCCGAGACCGTCAGGAGGGGG - Intronic
1152740211 17:82015440-82015462 GACTCGGGAACACCAGGAGAGGG - Intronic
1152874671 17:82779896-82779918 CACTTGGGAGGGCCAGGAGGCGG - Intronic
1154173522 18:12067519-12067541 TACACGGGACCCCCAGGAGGAGG - Intergenic
1160159194 18:76458571-76458593 TGCTCGGGACCCTCAGGACGGGG + Intronic
1162564971 19:11440998-11441020 GACTAGGGAGTGCCAGGAGGTGG - Intronic
1163420374 19:17210729-17210751 GACCCGGGACATCCAGGAGGAGG + Exonic
1165815678 19:38640572-38640594 TACTCCGAACAGCTAGGAGGTGG + Intergenic
1166015155 19:39974137-39974159 TACTGGGGACGGACAGCAGGAGG + Intronic
1166653249 19:44591339-44591361 TACTCGGACCTGTCAGGAGGTGG + Intergenic
1167456263 19:49597863-49597885 TGGTCGGGACCTCCAGGGGGCGG - Exonic
928572960 2:32627208-32627230 TACTCGGGACGGTGAGGCGGGGG - Intergenic
931681322 2:64751591-64751613 TACTCTGATCCGGCAGGAGGAGG + Intergenic
941277166 2:163503871-163503893 TACTGGGGCCCGTCAGCAGGTGG + Intergenic
947330971 2:229029058-229029080 CACTGGGGACCACCAGGAGGGGG + Intronic
1169228125 20:3868795-3868817 CACTTGAGCCCGCCAGGAGGCGG + Exonic
1176713249 21:10326639-10326661 CACTAGGGACTGCTAGGAGGGGG - Intergenic
1177662592 21:24105486-24105508 TACTGGGGACTGCTAGGAGGGGG + Intergenic
1180044715 21:45299976-45299998 CCCTCGAGACCCCCAGGAGGTGG + Intergenic
1181991483 22:26840121-26840143 GACTCTGGAAGGCCAGGAGGAGG + Intergenic
1183415774 22:37681055-37681077 TACTCTGTACCCCAAGGAGGAGG - Intergenic
950127969 3:10522186-10522208 TACACGGGACCACGAGGAGCTGG - Intronic
961650322 3:128413805-128413827 TGCTGGGGCCCGCCAGGTGGTGG - Intergenic
969626027 4:8306244-8306266 TGCCCCGGACAGCCAGGAGGAGG - Exonic
972104914 4:35471596-35471618 TACTGGGGACTGTCAGGGGGTGG + Intergenic
973714673 4:53663941-53663963 CACTGGGGACTGTCAGGAGGTGG - Intronic
977103303 4:92846327-92846349 TACTGGGGACTGCCAGAGGGAGG - Intronic
978529954 4:109703112-109703134 TACTCGGGACCGCCAGGAGGCGG + Intronic
981127612 4:141124336-141124358 TGCTGGGGACCAGCAGGAGGAGG + Intronic
982351223 4:154417139-154417161 CACTCGGGACCGGCCTGAGGTGG - Intronic
983523986 4:168741573-168741595 TACTCGGGACAGTGAGGTGGAGG + Intronic
985627694 5:998411-998433 AACTCGGGTCGGCCATGAGGAGG - Intergenic
986204563 5:5611260-5611282 TACTCACGTCCTCCAGGAGGTGG - Intergenic
990161830 5:52949623-52949645 TACTCTGGAGCTCCAGGAGTTGG + Intronic
995106864 5:108384886-108384908 AACTCCGGACAGCCAGGAGCTGG + Intergenic
998155364 5:139783567-139783589 TACTCATGACGGCCAAGAGGTGG - Intergenic
998507844 5:142686346-142686368 TACTCTGGACAGCCAGCAGCAGG + Intronic
999266782 5:150271657-150271679 TCCTTGGGACCGCCTGGTGGTGG - Intronic
1000017637 5:157292066-157292088 TACTAGTGACTTCCAGGAGGTGG - Intronic
1000376385 5:160586134-160586156 CACTGGGGACTGTCAGGAGGTGG - Intronic
1002072359 5:176687795-176687817 AACTCGGGACCGCCAAATGGTGG - Intergenic
1009751522 6:67883601-67883623 TACTTGTGACTTCCAGGAGGAGG + Intergenic
1009871719 6:69460873-69460895 TACTGGGGACCACTAGGTGGGGG + Intergenic
1016447712 6:144150357-144150379 CGCTCGGGACCGCCCGGAGCCGG - Intergenic
1019660188 7:2219779-2219801 TGCTCTGGAGCACCAGGAGGAGG - Intronic
1021528617 7:21617967-21617989 TCCTGGGGACAGCCTGGAGGAGG - Intronic
1021585864 7:22207449-22207471 GACTGGGGACAGCCAGGGGGTGG + Intronic
1021793281 7:24227794-24227816 TACTCGGGCCTGCCAGTGGGAGG - Intergenic
1029407736 7:100386624-100386646 TACTCAGGAGCCTCAGGAGGAGG - Intronic
1043068132 8:75602595-75602617 TACCCGGGACTGTCAGGGGGTGG + Intergenic
1044127266 8:88474098-88474120 GACTCTGGACCTCCAGCAGGAGG + Intergenic
1054783601 9:69189211-69189233 GCCTCGGGACAGCCTGGAGGAGG + Intronic
1061664749 9:132154011-132154033 TCACCGGGACCTCCAGGAGGGGG + Intergenic
1062333278 9:136053833-136053855 TACTTGGGACCCCCAGGAACCGG - Intronic
1190895967 X:54618305-54618327 GACTTGGGAAAGCCAGGAGGAGG - Intergenic
1197299299 X:124758602-124758624 TACTCAGGACAGCCAAGAGGTGG + Intronic
1198138221 X:133776283-133776305 TTCTTGGGAAGGCCAGGAGGGGG - Intronic