ID: 978529955

View in Genome Browser
Species Human (GRCh38)
Location 4:109703120-109703142
Sequence ACCGCCAGGAGGCGGCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 244}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978529948_978529955 1 Left 978529948 4:109703096-109703118 CCGGCGCCGGCGTCGCTACTCGG 0: 1
1: 0
2: 0
3: 4
4: 33
Right 978529955 4:109703120-109703142 ACCGCCAGGAGGCGGCAGCCAGG 0: 1
1: 0
2: 0
3: 26
4: 244
978529946_978529955 3 Left 978529946 4:109703094-109703116 CCCCGGCGCCGGCGTCGCTACTC 0: 1
1: 0
2: 0
3: 1
4: 43
Right 978529955 4:109703120-109703142 ACCGCCAGGAGGCGGCAGCCAGG 0: 1
1: 0
2: 0
3: 26
4: 244
978529947_978529955 2 Left 978529947 4:109703095-109703117 CCCGGCGCCGGCGTCGCTACTCG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 978529955 4:109703120-109703142 ACCGCCAGGAGGCGGCAGCCAGG 0: 1
1: 0
2: 0
3: 26
4: 244
978529951_978529955 -5 Left 978529951 4:109703102-109703124 CCGGCGTCGCTACTCGGGACCGC 0: 1
1: 0
2: 0
3: 2
4: 13
Right 978529955 4:109703120-109703142 ACCGCCAGGAGGCGGCAGCCAGG 0: 1
1: 0
2: 0
3: 26
4: 244
978529942_978529955 30 Left 978529942 4:109703067-109703089 CCGGAGGACAAAGGCGGCAGGGG 0: 1
1: 1
2: 0
3: 22
4: 237
Right 978529955 4:109703120-109703142 ACCGCCAGGAGGCGGCAGCCAGG 0: 1
1: 0
2: 0
3: 26
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978529955 Original CRISPR ACCGCCAGGAGGCGGCAGCC AGG Intronic
900150077 1:1174451-1174473 ACCGGCAGGAGACGGCACCCCGG - Exonic
900754053 1:4421173-4421195 ACAGACAGAAGGAGGCAGCCTGG - Intergenic
901024145 1:6270213-6270235 GCTGCGAGGAGGCAGCAGCCGGG - Intronic
901342932 1:8511881-8511903 ACCCCCATGAGGCTGCAGCCAGG + Intronic
901428564 1:9198806-9198828 GCCGCCAGGAGGTGGCCGTCGGG + Intergenic
901453179 1:9348591-9348613 TCCTCCAGGTGGGGGCAGCCAGG - Intronic
901629080 1:10639474-10639496 ACCACCGTGTGGCGGCAGCCCGG + Exonic
902349935 1:15847262-15847284 AACGCCAGGAGCTGGCCGCCAGG + Intergenic
902350117 1:15847981-15848003 AGCGCCGGGAGGCGGGTGCCGGG - Exonic
903349430 1:22709424-22709446 GCCACCAGGAGGAGGCAGCCTGG - Intergenic
903486378 1:23692058-23692080 ACGGTCAGGAGGCTGCAGCGGGG + Intronic
905181274 1:36168548-36168570 ACCAGCAGGAGACGGCTGCCTGG - Intronic
907767383 1:57424204-57424226 ACGGCCCGGCGGCGGCGGCCGGG - Intronic
912685180 1:111756276-111756298 ACCGACGGGCGGCGGCGGCCAGG + Intronic
915349007 1:155213054-155213076 ATCCCCAGGTGGCGCCAGCCTGG - Intronic
915352194 1:155233681-155233703 ATCCCCAGGTGGCGCCAGCCTGG - Intergenic
915558515 1:156673482-156673504 ACCGCCAGGTGTTTGCAGCCGGG + Exonic
915977436 1:160400477-160400499 ACAGCCGGGAGGCGGCACCCGGG + Intergenic
916019247 1:160778054-160778076 TCCCCCAGGAGAAGGCAGCCTGG + Intergenic
916051266 1:161038579-161038601 CTCGCGAGGAGGCGGCAGCTGGG - Exonic
916534869 1:165694261-165694283 ACTCCCAGGAAGAGGCAGCCTGG + Intronic
917959206 1:180128964-180128986 ACAGCCATGAGGCTGCTGCCAGG - Intergenic
919498459 1:198307408-198307430 ACCACCAGAAGGCTGCATCCTGG - Intronic
919650993 1:200148447-200148469 ACCCCCAGGAGGGGGCTGCCTGG - Intronic
920886997 1:209938560-209938582 GCCGGCAGGAGGCGGCGGCCCGG - Intronic
921272875 1:213488441-213488463 ACTGGCAGGAGGTGGCAGCAGGG + Intergenic
922529966 1:226337392-226337414 ACGGCCAGGAAGCAGCAGTCAGG + Intergenic
1064022762 10:11823205-11823227 ACCCCCGGGAGGCGGCCGCGAGG + Intergenic
1064028968 10:11870551-11870573 TCAGCCAGGAGGCCCCAGCCAGG - Exonic
1066733202 10:38451438-38451460 GCCGCCAGGAGGCCGGAGCTGGG - Intergenic
1069604029 10:69728826-69728848 ACCCCTAGCAGGAGGCAGCCTGG + Intergenic
1070610190 10:77927137-77927159 CCCTCCGGGAGGCGGCAGCAGGG + Intergenic
1072891538 10:99329492-99329514 GCAGCCAGGCGGCGGCGGCCGGG - Exonic
1073570952 10:104580831-104580853 ACCCCCAGGAAGAGGCATCCAGG - Intergenic
1075626535 10:123967846-123967868 ACAGCCAGCAGGGGGCAGGCTGG - Intergenic
1075655920 10:124161362-124161384 AGCGGGTGGAGGCGGCAGCCTGG - Intergenic
1075697343 10:124447069-124447091 GCCGCCAGCAGCTGGCAGCCAGG + Exonic
1075777120 10:124996277-124996299 GCCGCCAAGAGAGGGCAGCCTGG - Intronic
1076451598 10:130560535-130560557 CCCTCCAGGAGGTTGCAGCCCGG - Intergenic
1077208797 11:1358493-1358515 ATAGCCAGGAGGGAGCAGCCGGG - Intergenic
1077305972 11:1868845-1868867 GCGGCCAGCAAGCGGCAGCCAGG + Intronic
1081528496 11:43942811-43942833 CCCCCCGGGAGGCAGCAGCCGGG - Exonic
1084335892 11:68457706-68457728 ATGGGCAGGAGGGGGCAGCCAGG - Intergenic
1084510213 11:69598592-69598614 ACAGCAAGAAGGCGGCAGTCTGG + Intergenic
1084949210 11:72655335-72655357 ACAGCCAGGGTGAGGCAGCCTGG + Intronic
1089432557 11:118436254-118436276 GCGGGCAGGAGGCGGCGGCCCGG + Intergenic
1090433315 11:126664785-126664807 AGTGCCATGAGGCTGCAGCCAGG - Intronic
1091263701 11:134253876-134253898 ACCGACCGGAGGGGGCAGCCAGG - Intronic
1092169118 12:6362342-6362364 ACGGACAGGAGTCGGAAGCCAGG + Intronic
1092196274 12:6551414-6551436 GCGGGCAGGAGGCGGGAGCCCGG - Intronic
1092599082 12:10039125-10039147 ACCACCAGGAGGAGGAAGCAGGG - Intronic
1101150363 12:101877704-101877726 GCTGCCTGGAGGCGGCGGCCGGG - Exonic
1102178830 12:110896429-110896451 ACAGCCAGGAGAAGGAAGCCAGG - Intronic
1102197111 12:111033873-111033895 CCCGCCCGGGGGAGGCAGCCGGG - Intergenic
1102236868 12:111299058-111299080 ACAGCCAGGGGGCTCCAGCCCGG + Intronic
1103613343 12:122137402-122137424 AACGCCACCAGGAGGCAGCCTGG - Intronic
1103941241 12:124502421-124502443 AGAACCAGGAGGCGGCAGGCAGG + Intronic
1103980842 12:124736161-124736183 TACGCCAGGAGGCAGCAGCGGGG - Intergenic
1104643559 12:130482113-130482135 ACCGCACTGAGGTGGCAGCCAGG - Intronic
1105004155 12:132710783-132710805 GCCGCCCGGAAGCGGCAGCCGGG + Intergenic
1107935169 13:45340605-45340627 TCCGCCAGGAGGCGGCGGGGAGG + Intronic
1113774162 13:112933231-112933253 AGCCCAAGGAGACGGCAGCCTGG - Intronic
1119260880 14:73237559-73237581 GGCGCCGGGAGGCTGCAGCCAGG - Exonic
1119545742 14:75470013-75470035 CTGCCCAGGAGGCGGCAGCCGGG + Exonic
1121320250 14:92987918-92987940 GCCGGCATGAGGCGGCAGCTGGG - Intronic
1121442689 14:93958712-93958734 GCCGGCAGGTGGAGGCAGCCTGG + Intronic
1121859118 14:97299853-97299875 TCCACCAGAAGGAGGCAGCCTGG + Intergenic
1122079141 14:99254698-99254720 CCGGCCAGGAGGCAGAAGCCTGG + Intronic
1122152636 14:99733067-99733089 TCCTCCAGGCGGTGGCAGCCGGG + Intergenic
1122189035 14:100025341-100025363 GCCTCAAGGAGGAGGCAGCCTGG - Intronic
1122635373 14:103127263-103127285 ACCGCCAGGCGGCGGCGGCGGGG + Exonic
1122860182 14:104579034-104579056 ACAGCCCGGAGGTGGTAGCCTGG - Intronic
1122913130 14:104843486-104843508 GCGGCCAGGAGGAGGCCGCCGGG - Intergenic
1122919949 14:104875929-104875951 AAGGTCAGGTGGCGGCAGCCAGG - Intronic
1125031927 15:35082508-35082530 ACCTCCAAGATGGGGCAGCCAGG - Intergenic
1125524836 15:40368301-40368323 GCCGCCGGGCGGCGGCAGCGTGG - Exonic
1127877208 15:63121901-63121923 AGCCCCCGGGGGCGGCAGCCCGG - Exonic
1128311506 15:66634010-66634032 ATAGCCAGGAGGCGGGAGGCTGG - Intronic
1128809188 15:70557694-70557716 AGTGCCAGTAGGCGGCATCCAGG + Intergenic
1129238873 15:74240128-74240150 CTCACCAGGAGGCGCCAGCCTGG + Intronic
1129455950 15:75676256-75676278 CCCTCCAGGAGGCGGAAGCGCGG + Exonic
1129675838 15:77632214-77632236 AACCCCAGGAGGGCGCAGCCAGG + Intronic
1132495017 16:258750-258772 ACCTCCCGGAGGGGGCAGCTGGG + Intronic
1132660381 16:1058389-1058411 GCAGTCAGGATGCGGCAGCCGGG - Intergenic
1132833980 16:1943284-1943306 GCCTCCCGGAGGCGGAAGCCGGG - Exonic
1133040923 16:3059395-3059417 ACCGCCCCCTGGCGGCAGCCGGG - Exonic
1133124899 16:3640434-3640456 ACAGCCAGGAGGCGGGTTCCAGG - Intronic
1133855315 16:9544173-9544195 ACCGCCAGGAAGTTTCAGCCTGG + Intergenic
1134848400 16:17460585-17460607 ACAGCCAAGAGGGGCCAGCCAGG + Intronic
1135192986 16:20369865-20369887 ACCACAAGGAGGCTGAAGCCAGG - Intronic
1135240975 16:20806879-20806901 CCCGCTAGGAGGCGGCACGCGGG + Intronic
1135561245 16:23478674-23478696 ACCTCCAGGAAGCAGGAGCCTGG + Intronic
1138594179 16:58020841-58020863 ACTGCCAGTAGAGGGCAGCCTGG + Exonic
1141410654 16:83830603-83830625 AGCTGTAGGAGGCGGCAGCCTGG + Intergenic
1141831601 16:86512380-86512402 AGCCCCAGGAGGCAGGAGCCAGG + Intronic
1142245741 16:88969361-88969383 AAGGCCAGGAGGCACCAGCCGGG - Intronic
1144664918 17:17095842-17095864 ACAGCTAGGAGGAGGCAGGCTGG - Intronic
1144826592 17:18108778-18108800 ACCCCCATGAGGCGGCATGCAGG + Exonic
1145310757 17:21700026-21700048 CCCTCCAGAAGGAGGCAGCCAGG - Intronic
1146003948 17:29149113-29149135 ACCCCCAGGAGGCGTCCCCCAGG + Intronic
1146632273 17:34479439-34479461 ACCGCAGGGAGGCTGGAGCCTGG - Intergenic
1146661068 17:34665498-34665520 CCCACCAGGTGGAGGCAGCCAGG + Intergenic
1147484280 17:40797132-40797154 ACCGCAAGGACGCGGAGGCCTGG - Exonic
1148774408 17:50087622-50087644 GCTGCCAGTAGGGGGCAGCCTGG - Intronic
1151367330 17:73626108-73626130 ACCTCCAGGCAGCGGGAGCCTGG + Intronic
1152535913 17:80950267-80950289 ACCGGCAGGAGCCGGCAGAGGGG - Intronic
1152725337 17:81942222-81942244 GGAGGCAGGAGGCGGCAGCCTGG + Intronic
1152921356 17:83068138-83068160 ACCTGCAGGAGGCGACAGCGGGG + Intergenic
1157449211 18:47772814-47772836 ACCACCAGAAGGCGGCGCCCAGG + Intergenic
1158570899 18:58596334-58596356 GGCACCAGGAGGTGGCAGCCAGG - Intronic
1160148972 18:76385049-76385071 CGTGCCAGGAGGAGGCAGCCGGG + Intronic
1160710491 19:548977-548999 AGCGCCAGGTGGTGGCAGCAGGG + Exonic
1160855186 19:1214099-1214121 GCCTCCAGGAGGGGGAAGCCCGG - Intronic
1161287203 19:3474815-3474837 ACTGCCTGGAAGAGGCAGCCAGG + Exonic
1161641302 19:5425087-5425109 ACCTCCAAGAGGAGGCATCCAGG - Intergenic
1161736407 19:5994808-5994830 ACCTCGAGGAGGCGCCGGCCGGG + Exonic
1162435388 19:10654827-10654849 GCCGCGGGGAGGCGGCAGCCGGG - Intronic
1162731097 19:12719428-12719450 TCCCCCAGGAGCTGGCAGCCTGG - Intronic
1162966156 19:14157082-14157104 ACAGCCAGGAGAAGGCAGCCAGG + Exonic
1163699420 19:18779879-18779901 CCAGCCAGGAGCCAGCAGCCAGG + Exonic
1163828345 19:19535980-19536002 ACAGGCATGGGGCGGCAGCCAGG - Exonic
1164861164 19:31563396-31563418 ACCGCCAGGAGGCTGCTGACAGG + Intergenic
1166294682 19:41883200-41883222 AGAGCCAGGAAGCGGGAGCCGGG + Intronic
1168228650 19:55014777-55014799 AACACCAGGAGGAGGCAGCATGG + Exonic
1168267407 19:55230376-55230398 ACCCCCAGGAGGCTGGTGCCAGG - Exonic
1168636716 19:58002596-58002618 AACGCCCGGAGGCGGGAGGCCGG + Exonic
925116153 2:1379690-1379712 CCTGCCAGGAGGAGGGAGCCTGG - Intronic
925132760 2:1505129-1505151 ATGGCCAGGACGCGGCTGCCCGG + Intronic
925287911 2:2727723-2727745 ACAGCCTGGAGGAGGGAGCCAGG + Intergenic
926757827 2:16250248-16250270 ACCCCCAGGAGGAGCCAGGCAGG + Intergenic
927869699 2:26615702-26615724 ACCGCCAGGTGGCAGCGGCAAGG + Intronic
930684174 2:54290170-54290192 ATCGCGGGGCGGCGGCAGCCGGG - Intronic
934555241 2:95283566-95283588 TCCTCCAGGAGAAGGCAGCCTGG + Intronic
937289310 2:120772525-120772547 TCAGCCAGGAGTGGGCAGCCGGG - Intronic
937374026 2:121323032-121323054 ACCCCCAGCAGGTGGCAGACTGG - Intergenic
937436219 2:121884238-121884260 TCAGCCAGGAGGCTGCAGCAGGG - Intergenic
938082999 2:128380249-128380271 ACTCCCAGGGGGCGGGAGCCTGG - Intergenic
938133697 2:128737091-128737113 CCCGCCCGGAGGCGGCCGCGCGG - Intergenic
938343363 2:130549656-130549678 CCCGCCAGGAGGGCCCAGCCAGG - Intronic
938346470 2:130571066-130571088 CCCGCCAGGAGGGCCCAGCCAGG + Intronic
938368775 2:130756083-130756105 GGCGCAGGGAGGCGGCAGCCTGG + Intronic
938895178 2:135742268-135742290 ACAGCCACGGGCCGGCAGCCCGG - Intronic
940947603 2:159636305-159636327 ACCGTCAGGAGGTGGGAGCGGGG - Intergenic
941580589 2:167292721-167292743 ACCGCCAGGAGCCCGCGGCTTGG - Intergenic
941583769 2:167331697-167331719 ACCACCAGGGGGCCCCAGCCTGG - Intergenic
942346274 2:175005512-175005534 CCCCCCTGGAGGCGGCCGCCCGG + Intergenic
947981707 2:234415955-234415977 AGAGCCAGGAGGTGGCACCCAGG + Intergenic
948755169 2:240155272-240155294 ACCGCCCGGATGCCTCAGCCAGG - Intergenic
948824188 2:240566520-240566542 GCCGCCAGGGGGCGTCAGGCCGG + Intronic
1170393026 20:15895633-15895655 AGGGCCTGGTGGCGGCAGCCTGG + Intronic
1170756839 20:19212574-19212596 AGCGCCGGGAGGCGGCGGCGCGG + Intergenic
1170935297 20:20804627-20804649 ACCCCCTGAAGGAGGCAGCCCGG - Intergenic
1171490910 20:25516576-25516598 ACCTCAAGGAGGTGACAGCCTGG - Intronic
1174281294 20:49441440-49441462 TCGGCCAGTAAGCGGCAGCCAGG + Intronic
1174342812 20:49908381-49908403 ACCACCAGCAGGCAGCGGCCTGG - Exonic
1174353253 20:49982798-49982820 ACCGCCACGCGGCGCGAGCCCGG + Intergenic
1175716462 20:61257768-61257790 CCCGCCCGGAAGCTGCAGCCTGG + Intronic
1175729650 20:61345719-61345741 ACAGCAAGGAAGCGGCTGCCAGG + Intronic
1175814033 20:61874311-61874333 ACAGCCAGGCCGCCGCAGCCTGG - Intronic
1175883245 20:62272484-62272506 CCCGGCAGGAGGCGGCAGCAGGG - Intronic
1175923275 20:62459720-62459742 ACACCCTGGAGGAGGCAGCCCGG + Intergenic
1176022947 20:62971332-62971354 AAAGCCAGGAGGAGGCAGCAGGG + Intergenic
1176094223 20:63332604-63332626 GCAGCCAGGAGGAGGCAGCCTGG + Intronic
1178250841 21:31001774-31001796 CCAACCAGGAGGCGTCAGCCTGG + Intergenic
1179626903 21:42653979-42654001 AGCGCACGGAGGCCGCAGCCTGG - Intronic
1179974511 21:44856490-44856512 CACGCCAGGAGCCAGCAGCCTGG - Intronic
1180179799 21:46112887-46112909 GGCGCCAGGAGTCGGCAGCCTGG - Intronic
1181176804 22:21042464-21042486 AAGGCCAGAAGCCGGCAGCCTGG + Intergenic
1181849809 22:25742021-25742043 CTGGCCAGGAGACGGCAGCCCGG - Intergenic
1182074652 22:27487542-27487564 AGCTCCAGGAGGCTCCAGCCTGG - Intergenic
1182459215 22:30472196-30472218 CCTGCCAGGAGGAGGCAGCTGGG + Intergenic
1182618526 22:31604894-31604916 TCCTCCGGGAGGTGGCAGCCAGG + Exonic
1183606409 22:38868984-38869006 AGCCCCAGGAGGCCCCAGCCTGG - Intronic
1184116460 22:42425563-42425585 GCGGGCAGGAGGCGGCAGACAGG - Intronic
1184431223 22:44442408-44442430 ACCGCCAGGAGGGGACACCAAGG - Intergenic
1184684520 22:46090131-46090153 GCCGCCAGGAGCCGCCTGCCCGG - Intronic
1184914674 22:47561417-47561439 ACCCACAGGAGGGGGCACCCAGG + Intergenic
1185278620 22:49960653-49960675 CCCGCGAGGCGGCGGCGGCCGGG - Exonic
953374629 3:42418377-42418399 ACAGCCAGGATGTGGGAGCCAGG - Intergenic
954390899 3:50267500-50267522 ACCAGCTGGAGACGGCAGCCAGG - Intergenic
961066311 3:123880263-123880285 TCTGGCAGGAGGAGGCAGCCAGG - Intronic
967316255 3:188154232-188154254 ACCTCAGGGAGGAGGCAGCCGGG - Intronic
968372906 4:11745-11767 GCCGCAAGGAGGGGGCAACCTGG - Intergenic
968923573 4:3535324-3535346 AGCGCCAGGTGGCTGCAGGCAGG + Intergenic
969007998 4:4037083-4037105 AACGCCATGAGGCGAGAGCCGGG - Intergenic
970489462 4:16557480-16557502 ACTGCAAGGCGGCGGCAGCGAGG + Intronic
978529955 4:109703120-109703142 ACCGCCAGGAGGCGGCAGCCAGG + Intronic
983261701 4:165463973-165463995 ACAGTGAGAAGGCGGCAGCCAGG - Intronic
983645957 4:169991759-169991781 AGGGCCAGGAGGCCGCAGACAGG - Exonic
985462490 4:190120822-190120844 GCCGCAAGGAGGGGGCAACCTGG + Intergenic
985484324 5:140239-140261 AGCAGCAGGAGGCGGCCGCCGGG + Exonic
985827136 5:2200807-2200829 ACAGCCAGGAGGAAGCAGACAGG - Intergenic
990381876 5:55227163-55227185 ACTGCTCGGAGGCGGCGGCCCGG + Exonic
997537333 5:134632889-134632911 ACTGCCAGGAGGCGGAACCTAGG - Exonic
998053889 5:139057480-139057502 ACTGCCAGGAGGGGGCAGGTGGG - Intronic
999278791 5:150350731-150350753 ACCTCCGGGAGGAAGCAGCCAGG + Intergenic
1001020444 5:168178227-168178249 CCCGGCAGGGGGTGGCAGCCTGG - Intronic
1001035290 5:168292454-168292476 ACCGAGAGGAGGCGCCTGCCGGG + Intronic
1006089759 6:31621193-31621215 ACCACCACGGGGCGGCAGCCGGG - Intronic
1006197590 6:32255265-32255287 ACCGCCAGGCGGCGACACCTAGG - Intergenic
1006374864 6:33666230-33666252 ACAGCTAGGAAGCGGCAGCCAGG + Intronic
1007697015 6:43740485-43740507 CCCACCAGGACGCTGCAGCCAGG - Intergenic
1008932523 6:56955113-56955135 ACGGCCAGGCTGCGGCAGCGCGG + Intronic
1012170781 6:96015382-96015404 CCCGCCAGAAGGCGCCAGCAGGG - Intergenic
1012450674 6:99349899-99349921 ACCGCGAGGAAGCTGCAGTCGGG + Intronic
1012912889 6:105137178-105137200 GGCGGCAGGCGGCGGCAGCCAGG + Intergenic
1013338143 6:109186328-109186350 ACCGCCACAAGGCTGCAGCCAGG + Intergenic
1014272249 6:119348733-119348755 GCCGCGAGGAGGGGGCACCCGGG - Exonic
1016657987 6:146543494-146543516 ACCGCCAGGAGGCGCCGCCCGGG + Intergenic
1017914311 6:158819461-158819483 CCCGCAAGATGGCGGCAGCCGGG + Intergenic
1018372288 6:163179254-163179276 ACAGAAAGGAGGCGGCAGCTGGG + Intronic
1019301608 7:307019-307041 ACTTCCTGGAGGAGGCAGCCTGG - Intergenic
1019302223 7:311605-311627 CCCTCCTGGAGGAGGCAGCCTGG + Intergenic
1019522431 7:1466932-1466954 CCCGCCTGGAGAAGGCAGCCCGG + Intergenic
1021929819 7:25569055-25569077 ACCGCCAGGGGTCGGTAGCGAGG - Intergenic
1022103318 7:27182009-27182031 AAAGCCAAGAGGCTGCAGCCAGG - Exonic
1025976759 7:66376643-66376665 GCCGCCGGGAGGCGGGAGCTGGG + Intronic
1026472873 7:70709247-70709269 ACCGCAAGGAGGTGGCAGGAGGG + Intronic
1026846196 7:73700335-73700357 CCAGCCAGGTGGCAGCAGCCAGG + Exonic
1028548191 7:92027201-92027223 ACCTCCCAGACGCGGCAGCCGGG - Intronic
1029488750 7:100858952-100858974 ACCCCCAGGAGGCAGCAGGCAGG - Intronic
1029640270 7:101815951-101815973 GCCGCCAGGAGGCAGCAGGCGGG - Intronic
1032082950 7:128869240-128869262 ACCGCCAGGAGGACGCGGCTGGG - Intronic
1032201436 7:129825507-129825529 ACCGCTAGGAGGGGGCATCCTGG - Intergenic
1034129146 7:148699322-148699344 CGCGCCTGGAGGCGGCGGCCTGG + Intronic
1034427389 7:151021271-151021293 CCAGCCAGAAGCCGGCAGCCAGG + Exonic
1035039863 7:155919758-155919780 CCAGCCAGGAGGCGGCAGCAGGG + Intergenic
1035236106 7:157498498-157498520 AATGCCAGGAGGCGGGAGGCAGG + Intergenic
1035446047 7:158943891-158943913 TCAGGAAGGAGGCGGCAGCCCGG + Intronic
1037317986 8:17617014-17617036 ACCCCCAGGAGAGAGCAGCCTGG + Intronic
1037804917 8:22053797-22053819 GCAGGCAGGAGGCGGCTGCCAGG - Intronic
1040531084 8:48266903-48266925 ACAGCCAGAGGGAGGCAGCCTGG + Intergenic
1041018668 8:53616483-53616505 ACCTCCAGGAGGGGGGAGTCCGG + Intergenic
1041272520 8:56123072-56123094 ACAGGCATGAGGCAGCAGCCTGG - Intergenic
1049719330 8:144108371-144108393 GCCGCCTGGAGGTGGCAGCCGGG + Exonic
1049799104 8:144509587-144509609 AGCTCCAGGAGGGGGCAGCCCGG - Exonic
1049799164 8:144509840-144509862 CCAGCCAGTAGGTGGCAGCCAGG - Exonic
1050744141 9:8857726-8857748 GCCGCCCGGAGGCGGCGGCGCGG - Intronic
1053050512 9:34957894-34957916 CCCGCCCGGAGGAGGCGGCCCGG - Intronic
1053569746 9:39291917-39291939 ATCCCCAGAAGGCAGCAGCCGGG + Intergenic
1053799282 9:41754348-41754370 AGCGCCAGGTGGCTGCAGGCCGG + Intergenic
1053835709 9:42132949-42132971 ATCCCCAGAAGGCAGCAGCCGGG + Intergenic
1054091376 9:60850922-60850944 ATCCCCAGAAGGCAGCAGCCGGG + Intergenic
1054112791 9:61126492-61126514 ATCCCCAGAAGGCAGCAGCCGGG + Intergenic
1054127402 9:61327096-61327118 ATCCCCAGAAGGCAGCAGCCGGG - Intergenic
1054145931 9:61560651-61560673 AGCGCCAGGTGGCTGCAGGCAGG - Intergenic
1054172333 9:61854013-61854035 ACCGCCGCGCGGCGGCAGCGAGG - Intergenic
1054447189 9:65383040-65383062 GCCGCCTGGCGGCGGCAGCGAGG - Intergenic
1054465673 9:65491755-65491777 AGCGCCAGGTGGCTGCAGGCCGG - Intergenic
1054530702 9:66179776-66179798 ACCGCCTGGAGCCTGGAGCCTGG + Intergenic
1054594921 9:67055656-67055678 ATCCCCAGAAGGCAGCAGCCAGG - Intergenic
1054665204 9:67726792-67726814 ACCGCCGCGCGGCGGCAGCGAGG + Intergenic
1057172117 9:92969252-92969274 GCCGACAGCAGGTGGCAGCCAGG - Intronic
1057187062 9:93062889-93062911 ACAGCCAGGATGGGGCAGGCAGG - Intronic
1057203900 9:93159218-93159240 ACCCCCAGGAGCCAGGAGCCAGG - Intergenic
1057352847 9:94315242-94315264 TTGGCCAGGAGGGGGCAGCCTGG + Intergenic
1057654900 9:96942349-96942371 TTGGCCAGGAGGGGGCAGCCTGG - Intronic
1059390164 9:113994168-113994190 CCAACCAGGAGGCAGCAGCCAGG + Intronic
1061236600 9:129346699-129346721 GCCACCAGCAGGAGGCAGCCTGG - Intergenic
1062277539 9:135737886-135737908 AGCTGCAGGAGGCTGCAGCCAGG - Intronic
1062400530 9:136370721-136370743 ACCGCCTGGAGGGGACAGCCAGG - Intronic
1203561132 Un_KI270744v1:59758-59780 ACCGCCAGGGAGCGGCTTCCGGG - Intergenic
1186660520 X:11664535-11664557 AGGTCCAGGAGGCGGTAGCCTGG + Exonic
1188451008 X:30308378-30308400 ACCACCAGGCGGCGGGAGACCGG - Exonic
1189407117 X:40735355-40735377 CCCGCCCGGAGGCGGCGGCGGGG - Exonic
1189665687 X:43352192-43352214 ACCGCCAGTAGGAGTCAGGCAGG - Intergenic
1190012438 X:46796776-46796798 ACAGCCAGCAGGTGGCAGCAGGG - Intergenic
1192230958 X:69264611-69264633 CCAGCAACGAGGCGGCAGCCTGG + Intergenic
1192669825 X:73127932-73127954 ACCCCCAGGTGCCGGCGGCCCGG - Exonic
1195469983 X:105220014-105220036 AACGCAAGGAGGCGGCCTCCCGG - Exonic
1200071736 X:153532554-153532576 AGCCCCTGGAGGCAGCAGCCAGG + Intronic