ID: 978539466

View in Genome Browser
Species Human (GRCh38)
Location 4:109801525-109801547
Sequence CGCTCTATAGTTATAGAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 66}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978539466_978539470 -3 Left 978539466 4:109801525-109801547 CCCCTTTCTATAACTATAGAGCG 0: 1
1: 0
2: 1
3: 2
4: 66
Right 978539470 4:109801545-109801567 GCGTACTAAGAGGCTGTTGAAGG 0: 1
1: 1
2: 0
3: 1
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978539466 Original CRISPR CGCTCTATAGTTATAGAAAG GGG (reversed) Intronic