ID: 978551756

View in Genome Browser
Species Human (GRCh38)
Location 4:109935023-109935045
Sequence TAGGATTTTCTTGGGTATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4772
Summary {0: 1, 1: 1, 2: 138, 3: 1810, 4: 2822}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978551750_978551756 -3 Left 978551750 4:109935003-109935025 CCAGCTTTGTTCTTTTTGCTTAG 0: 4237
1: 15281
2: 7082
3: 3563
4: 2533
Right 978551756 4:109935023-109935045 TAGGATTTTCTTGGGTATAGGGG 0: 1
1: 1
2: 138
3: 1810
4: 2822
978551749_978551756 0 Left 978551749 4:109935000-109935022 CCTCCAGCTTTGTTCTTTTTGCT 0: 4275
1: 15501
2: 7334
3: 4236
4: 3694
Right 978551756 4:109935023-109935045 TAGGATTTTCTTGGGTATAGGGG 0: 1
1: 1
2: 138
3: 1810
4: 2822

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978551756 Original CRISPR TAGGATTTTCTTGGGTATAG GGG Intronic
Too many off-targets to display for this crispr