ID: 978555013

View in Genome Browser
Species Human (GRCh38)
Location 4:109970568-109970590
Sequence ATCTGTTGATGTGCTTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978555005_978555013 30 Left 978555005 4:109970515-109970537 CCTAGAAATATCTCTTTTTATCA 0: 1
1: 0
2: 4
3: 43
4: 567
Right 978555013 4:109970568-109970590 ATCTGTTGATGTGCTTTGGGAGG 0: 1
1: 0
2: 1
3: 12
4: 196
978555010_978555013 0 Left 978555010 4:109970545-109970567 CCATGGGAAACAGGTTTTTAAAA 0: 1
1: 0
2: 4
3: 64
4: 505
Right 978555013 4:109970568-109970590 ATCTGTTGATGTGCTTTGGGAGG 0: 1
1: 0
2: 1
3: 12
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978555013 Original CRISPR ATCTGTTGATGTGCTTTGGG AGG Intronic
904104433 1:28066295-28066317 ATCTGTAGTTTTGCTTTTGGCGG - Intronic
905990341 1:42332241-42332263 ATCAGTAGATGTGTGTTGGGAGG - Intronic
905996173 1:42382044-42382066 ATCTGTTACTTTGCTTTGGCAGG + Intronic
906574696 1:46877339-46877361 ATCTGGTGATGATCTTTGAGAGG - Intergenic
906597277 1:47090565-47090587 ATCTGGTGATGATCTTTGAGAGG + Intronic
907208837 1:52800477-52800499 ATCTACTCATATGCTTTGGGAGG + Intronic
907624000 1:56010707-56010729 ATCTGGTGATGTGCAGTTGGGGG - Intergenic
908900400 1:68949934-68949956 ATCTGTGGAGGTGCCTTGAGGGG + Intergenic
909716877 1:78718798-78718820 ATGTGTTTATGTGTTTTGGTTGG - Intergenic
910056619 1:83040528-83040550 ATCTTTTGCTGTCCTTAGGGAGG + Intergenic
910392863 1:86762593-86762615 CTCTGTTGATTTGCTTGGAGCGG - Intergenic
910857331 1:91708648-91708670 ATCTAAAGGTGTGCTTTGGGAGG - Exonic
915008909 1:152666342-152666364 ATGAGTTCATGTCCTTTGGGGGG - Intergenic
917992234 1:180393004-180393026 ACCTTTTAATGTGCTTTGGGGGG + Intronic
918168959 1:181976840-181976862 ATGTTTTGATGTGCTTTTGTAGG - Intergenic
920632832 1:207669422-207669444 GTTTGTAGATGTGCTTCGGGAGG + Intronic
920673076 1:208019391-208019413 TTCTGTGCATGTGCTTTGGTGGG + Intergenic
1064260224 10:13779596-13779618 ATCTGTTAATTTGCTTTCTGTGG + Intronic
1065137328 10:22684827-22684849 ATCTGAAGTTGTGCTTTGGTGGG + Intronic
1065976739 10:30848253-30848275 TTCTGTGGATGTGATTTTGGGGG + Intronic
1066351901 10:34643364-34643386 TTCTGTTCATGTGCTATGGCTGG - Intronic
1066416901 10:35230129-35230151 ATCTATTTGTGTGCTTGGGGTGG + Intergenic
1068237978 10:54263274-54263296 ATCTCATGGTGTGCTTTGGCAGG - Intronic
1068996929 10:63217129-63217151 AATTGTTGATGTATTTTGGGGGG + Intronic
1069458693 10:68574231-68574253 ATCTGTTGTTGTGCCTCTGGAGG + Exonic
1071594335 10:86908211-86908233 ATCTTTTGTTTTTCTTTGGGTGG - Intronic
1072332197 10:94364685-94364707 ATATGTTGATATGCTTGGGAGGG - Intergenic
1072487336 10:95868381-95868403 TTCTGTTCATGTGCTTTGGATGG + Exonic
1075914590 10:126156663-126156685 GTGCGTGGATGTGCTTTGGGTGG + Intronic
1077823677 11:5779904-5779926 ATATGTTGATGTGACCTGGGTGG - Intronic
1078581002 11:12539562-12539584 ATCTGCTGATGTGCAGTGTGGGG - Intergenic
1079766711 11:24403092-24403114 ATCTGTTTATGTCCTTTGTCCGG + Intergenic
1080939128 11:36894982-36895004 GTCAGTTAATGTGTTTTGGGAGG - Intergenic
1081020504 11:37941738-37941760 ATCTGTTTTTGTTTTTTGGGGGG + Intergenic
1083371589 11:62186419-62186441 CTCTGATGAAGTGCTTTGGCAGG - Intergenic
1085471066 11:76758404-76758426 GTCTGTTGATGGGCACTGGGTGG + Intergenic
1086131771 11:83408826-83408848 ATCTGTTCATGCAGTTTGGGTGG - Intergenic
1088983941 11:114889261-114889283 AACTGATGATGTACTTTGGAGGG + Intergenic
1089052298 11:115556488-115556510 ATGTGTTGAATTACTTTGGGAGG + Intergenic
1089672310 11:120065014-120065036 CACTGTTGGTGTGCATTGGGGGG - Intergenic
1089877925 11:121743690-121743712 ATATTTTGATGTTCCTTGGGTGG + Intergenic
1091173755 11:133541689-133541711 ATCTATTGATTTGCATTTGGTGG + Intergenic
1092710265 12:11329083-11329105 TTGGGTTTATGTGCTTTGGGTGG + Intergenic
1093101918 12:15038162-15038184 ACCTGATGAAGTGCTTTGGCCGG - Intergenic
1094289749 12:28833597-28833619 AGCAGTTGCTGTCCTTTGGGTGG - Intergenic
1095201279 12:39387374-39387396 TTCTGGTTATGTCCTTTGGGAGG - Intronic
1095811381 12:46375644-46375666 ATGTCTTGCTGTGGTTTGGGGGG + Intergenic
1096564199 12:52462802-52462824 ATTGGTTGATGTGGTTTAGGTGG - Intergenic
1097301756 12:58026581-58026603 ATCTGTTGATTTGCTCTGGGAGG + Intergenic
1098922808 12:76318321-76318343 ATCTGGTGATGAGCCTTTGGAGG + Intergenic
1100042719 12:90340460-90340482 ATTTGTTAATGTGCATTGAGGGG + Intergenic
1103135139 12:118500451-118500473 AGCTGCTGCTGTGCTGTGGGAGG + Intergenic
1104703619 12:130925992-130926014 TTTGGTTGATGTGGTTTGGGAGG + Intergenic
1105343797 13:19554706-19554728 ATTTGTTGATATGCTTTAGTGGG - Intergenic
1106788689 13:33132276-33132298 ATGTTTTGATGTGTTATGGGAGG + Intronic
1107453994 13:40537490-40537512 ATCTTTTAAAGGGCTTTGGGAGG - Intergenic
1107477305 13:40750994-40751016 ATTTGTTGATATGCTTTAGTGGG - Intronic
1108620432 13:52177793-52177815 ATTTGTTGACATGCTTTAGGGGG - Intergenic
1108666320 13:52635261-52635283 ATTTGTTGACATGCTTTAGGGGG + Intergenic
1108727383 13:53198035-53198057 ATCTTTTGATGTTCTGTAGGTGG + Intergenic
1115395512 14:32904003-32904025 ATATGTTTGTGTGGTTTGGGAGG + Intergenic
1116660776 14:47707919-47707941 TTCAGATGATGTGATTTGGGGGG + Intergenic
1116842332 14:49831776-49831798 ATCTGTTCAAGTTCTTTGAGTGG - Intronic
1120496810 14:85248035-85248057 ATCAGTTCATGTCCTTTGTGGGG - Intergenic
1121840421 14:97129484-97129506 AGCTGGTGATGAGATTTGGGTGG + Intergenic
1126473330 15:49040012-49040034 ATGAGTTGATATGTTTTGGGGGG - Intronic
1126491829 15:49245614-49245636 GTCTGTTGATGGGTTTTGGGTGG + Intronic
1127718946 15:61680975-61680997 ATTAGTTGATGCCCTTTGGGTGG - Intergenic
1130318054 15:82813487-82813509 ATGTAATGCTGTGCTTTGGGAGG - Intronic
1130745010 15:86642832-86642854 ATCTTTTTCTGTGCTTTAGGAGG + Intronic
1133920172 16:10145786-10145808 ATCTGTAGATGTGCTTTCTATGG - Intronic
1133975218 16:10595708-10595730 ATATGTTGATTTGCTTTTGTCGG - Intergenic
1134078532 16:11308977-11308999 ATCTGCAGCTGTGGTTTGGGTGG + Intronic
1135052094 16:19201469-19201491 CTCTTTTGCTGTGATTTGGGTGG - Intronic
1135351339 16:21731757-21731779 GTGTGTGGATGTGCTTTGTGGGG - Intronic
1135449822 16:22547883-22547905 GTGTGTGGATGTGCTTTGTGGGG - Intergenic
1135485627 16:22862356-22862378 ATCTGTTGAAGTGGTTTGATTGG + Intronic
1136184002 16:28574408-28574430 TTCTGGTGATGTGCCCTGGGAGG + Intronic
1137900638 16:52264213-52264235 ATCTGTTGAAGTGCTTTGTTTGG + Intergenic
1138405392 16:56788726-56788748 ATCTGTTGCTGCACTTGGGGAGG - Intronic
1138712646 16:58986680-58986702 ATCTGTACATGTTGTTTGGGGGG + Intergenic
1139473401 16:67190180-67190202 TTCTGTTGATGGCCTTGGGGAGG - Exonic
1139500099 16:67355987-67356009 ATGTGTCGGTGTGGTTTGGGTGG + Intronic
1140716467 16:77730280-77730302 AGCTGCTGAGGTGGTTTGGGGGG - Intronic
1142629664 17:1216635-1216657 GTCTGCTGATGTGCTTTGTTTGG - Intronic
1142937195 17:3344708-3344730 TTCAGTTTATGAGCTTTGGGTGG + Intergenic
1152395806 17:80032305-80032327 TTCTGTTGCTGAGCCTTGGGCGG - Intronic
1154100680 18:11470224-11470246 AACTGGTGATGAGATTTGGGTGG + Intergenic
1156182899 18:34626668-34626690 ATCTATTACTGTGTTTTGGGTGG - Intronic
1156240025 18:35244326-35244348 ATCTGATGATGTGTTTAGGTTGG + Intronic
1156322649 18:36041775-36041797 ATCTCTTGATATGCTTTCTGTGG - Intronic
1158398926 18:57103610-57103632 TTCTGTTGGTGACCTTTGGGTGG + Intergenic
1158778365 18:60615324-60615346 AGCTGTTTATATGTTTTGGGGGG - Intergenic
1158837149 18:61343030-61343052 ATCTATTAATGGGCTTTTGGGGG - Intronic
1159176216 18:64838217-64838239 ATTTGTTGAATTGCTTTGTGAGG - Intergenic
1160523538 18:79522488-79522510 ATCTGCTGATGTGTTTTGTGTGG + Intronic
1161763485 19:6191823-6191845 ATTTGTTGATGTCTTGTGGGTGG + Intronic
1163516375 19:17766448-17766470 ATTTGTTGAGGGGCCTTGGGAGG + Intronic
1165608506 19:37129149-37129171 ATCTGATGCTGTGCTTTATGAGG - Exonic
1166486660 19:43219828-43219850 ATCTGTAGATATGAATTGGGAGG + Intronic
927070866 2:19528237-19528259 ATTTGTTGCTGTGATTTGTGTGG - Intergenic
929417614 2:41759785-41759807 CTCAGTTCATGTGCTTTGGGTGG - Intergenic
934029895 2:88033929-88033951 ATCAGTTGATGGGCATTGGTTGG - Intronic
934106189 2:88696815-88696837 AGATGTTGAAGTGCTATGGGTGG + Intronic
936707724 2:115095365-115095387 ATATGCAGATGGGCTTTGGGAGG + Intronic
936906845 2:117546275-117546297 AACTGAAGATGAGCTTTGGGTGG - Intergenic
938398893 2:130971736-130971758 ATCTGTAGATCAGTTTTGGGAGG + Intronic
939429108 2:142080110-142080132 ATGTCTTGATGTTCTTTGTGGGG - Intronic
942175789 2:173333468-173333490 AACTATTGATATGGTTTGGGTGG - Intergenic
946666454 2:222054664-222054686 ATGTGATGATATGCTTTTGGAGG + Intergenic
948489285 2:238301996-238302018 ATCTGTTGAATTGCTTTCTGTGG - Intergenic
1170267991 20:14489229-14489251 TTCTGTTGATTTTGTTTGGGAGG + Intronic
1175799523 20:61793367-61793389 ATCTGTTTATGTGCCTTTGGAGG - Intronic
1178713475 21:34941934-34941956 AACTGTTGATTTTCTTTTGGAGG + Intronic
1178777798 21:35568900-35568922 ATCTCTGGATGTGTTGTGGGAGG - Intronic
1184818028 22:46886845-46886867 ATCTGTTTATGTACTGTGTGTGG - Intronic
954001751 3:47563083-47563105 ATGTGTTGATGAGCTCTGCGGGG + Intronic
956920821 3:73927322-73927344 TTGTGTGCATGTGCTTTGGGCGG + Intergenic
957569803 3:81931987-81932009 TTCTATTGATGTGGTTTTGGGGG - Intergenic
959219945 3:103505507-103505529 ATCTGTTGATGTCCTGTGATGGG + Intergenic
960609475 3:119542207-119542229 ATATGGTGATGTGATTTGAGGGG - Intronic
963360692 3:144268742-144268764 ATGAGTTGATGTGCTATGGATGG + Intergenic
968692425 4:2000326-2000348 ATTTGTTGATATTTTTTGGGGGG - Intronic
970299658 4:14667966-14667988 ATCTCTTGATGGGCACTGGGGGG + Intergenic
970680357 4:18500015-18500037 ATGAGTTCATGTGCTTTGCGGGG + Intergenic
971876604 4:32316843-32316865 ATCTGATTATGTTCTTTAGGAGG - Intergenic
973305099 4:48638786-48638808 ATGTGTTCATGTCCTTTGCGGGG + Intronic
974589907 4:63932982-63933004 ATCTGTGGATTTGTTATGGGTGG - Intergenic
975495087 4:75028336-75028358 ATCTGTGGATGTGCTGGAGGAGG - Intronic
976326720 4:83780025-83780047 ATCTGTTGGGTTGATTTGGGTGG - Intergenic
976642980 4:87358866-87358888 AATTGTTGATGAGATTTGGGTGG - Intronic
977398279 4:96498925-96498947 TTCTGCTGATGTGCTGTTGGAGG - Intergenic
977654603 4:99506160-99506182 ATCTGCTGATGGACTTAGGGAGG + Intergenic
978555013 4:109970568-109970590 ATCTGTTGATGTGCTTTGGGAGG + Intronic
978598006 4:110399704-110399726 ATGTGTTTTTGTGTTTTGGGAGG - Intronic
978853123 4:113362185-113362207 TTTTGTTGATGGGCTTTAGGTGG + Intronic
981504420 4:145482984-145483006 TTTTCTTGATGTGCTTTAGGAGG + Exonic
981953982 4:150447594-150447616 ATCGGCTGATGTGATTAGGGAGG - Intronic
982570608 4:157046250-157046272 AATTGTTGATGAGATTTGGGTGG - Intergenic
986529726 5:8723813-8723835 AATTGTTGATGAGTTTTGGGTGG - Intergenic
989767030 5:45099296-45099318 GTCAGTTGATATGTTTTGGGTGG + Intergenic
989771304 5:45149683-45149705 ATTTGCTGCTGTGGTTTGGGAGG - Intergenic
989785435 5:45322216-45322238 AGGTGTTAATGGGCTTTGGGTGG + Intronic
991308394 5:65207486-65207508 ATCAGTTAATGGGCTTTGGAAGG + Intronic
992065822 5:73107030-73107052 ATCTTTTCATGTGCTTAGTGGGG + Intergenic
993661872 5:90647559-90647581 ATCTGTTGATGTGACTTGCATGG + Exonic
993889861 5:93460663-93460685 GTCTGTTCATGTCCTTTGGGTGG - Intergenic
994897329 5:105722301-105722323 ATCTGGTGATGAGCTATTGGGGG - Intergenic
995798609 5:115966602-115966624 ACCTGTACAAGTGCTTTGGGAGG - Intronic
996033792 5:118735558-118735580 ATGTGTTGGTTTTCTTTGGGTGG - Intergenic
996388793 5:122937895-122937917 TTTTGTTTATGTGTTTTGGGAGG + Intronic
996868822 5:128162420-128162442 ATCTGGAGATGTGTTTTGTGTGG - Intronic
997738860 5:136236169-136236191 ATGTGTTTCTGTGCTTTTGGAGG + Intronic
1005252007 6:23957517-23957539 ATCTATTAATATGCTTTGGTCGG + Intergenic
1005922416 6:30414527-30414549 AACTGAAGATGTGATTTGGGTGG + Intergenic
1006427076 6:33972202-33972224 ATCTGTAGATGAGTTTTGAGAGG - Intergenic
1010095576 6:72039681-72039703 ATCTGGTTCTGTGATTTGGGTGG + Intronic
1010272189 6:73927211-73927233 GTCTGATGAAGTGCTTTGGCTGG + Intergenic
1011542723 6:88449583-88449605 ATCTGTTGATGGACATTAGGTGG - Intergenic
1011955849 6:93024838-93024860 ATCTGAAGATGAGATTTGGGTGG + Intergenic
1012107526 6:95182821-95182843 AACTGTAGATGAGCTTTGGATGG - Intergenic
1012314618 6:97770308-97770330 ATTTGTTGATTTTCTTTGGAAGG + Intergenic
1014152272 6:118071596-118071618 TTCTGGTGATGTGCTCTAGGGGG - Intronic
1014597434 6:123362146-123362168 AACTGATGATAAGCTTTGGGAGG - Intronic
1014726462 6:124977616-124977638 CTCTGTTGGTTTGCTTAGGGTGG + Intronic
1015824879 6:137300970-137300992 ATATGTTGGCATGCTTTGGGGGG + Intergenic
1016154205 6:140783507-140783529 ATCTGTTCATGTCTTTTGGGAGG - Intergenic
1018464982 6:164035691-164035713 CTATGTTGCTGTGCTTGGGGAGG - Intergenic
1021674569 7:23067334-23067356 ATCTGTCTGTGTGATTTGGGGGG + Intergenic
1021897550 7:25251231-25251253 ATCTGATGATGTCCACTGGGTGG + Intergenic
1022828087 7:34037077-34037099 ACCTGTAATTGTGCTTTGGGAGG + Intronic
1024183733 7:46926102-46926124 ATCTGTAGATTTCCTTTGGGTGG - Intergenic
1024376541 7:48645260-48645282 ATATATTTATGTGATTTGGGAGG + Intronic
1025551673 7:62257212-62257234 AGCTTTGGATGTGCTTTGGAAGG - Intergenic
1026406890 7:70075153-70075175 ATCTTTTGATGTCCAGTGGGAGG - Intronic
1026656030 7:72257285-72257307 AATTGTTGATGAGGTTTGGGTGG + Intronic
1028241484 7:88426246-88426268 ATTGGTTCATGAGCTTTGGGGGG - Intergenic
1029033866 7:97497980-97498002 AATTGTTGATGAGATTTGGGTGG - Intergenic
1033534131 7:142296666-142296688 ATCTTTTGGGGTGCTTTTGGGGG - Intergenic
1034929082 7:155146293-155146315 ATCTGTTGCTTTGATATGGGTGG - Intergenic
1037186905 8:16075364-16075386 ATCTGATAATATGCTTTTGGTGG - Intergenic
1038684618 8:29704973-29704995 ATTAGTTGATGTGCATTGGTTGG + Intergenic
1039952605 8:42183586-42183608 ATCTGATGATGGGCTTGGGAAGG + Intronic
1040140234 8:43901098-43901120 ATCTGTGAAAGTGCTTTGTGAGG + Intergenic
1041585804 8:59517402-59517424 ATCACCTGAGGTGCTTTGGGAGG + Intergenic
1042759777 8:72257812-72257834 ACCTTTTGATGAGGTTTGGGTGG - Intergenic
1045529368 8:102970038-102970060 CTCTGTCCATGTGCTTGGGGTGG + Intronic
1046413480 8:113879287-113879309 GTCTGTAGAATTGCTTTGGGCGG - Intergenic
1046646031 8:116786622-116786644 CTCTGTTGATGTGGTTTAAGTGG - Intronic
1049395532 8:142398412-142398434 GGCTGGGGATGTGCTTTGGGAGG - Intronic
1050112529 9:2231684-2231706 TTCTGTTCATGTGGTTTGGATGG - Intergenic
1051376460 9:16407449-16407471 TTCTGTTGATTTGATTTGGGTGG - Intergenic
1052377977 9:27739510-27739532 TTCTGTTGTTTTGTTTTGGGTGG + Intergenic
1055525290 9:77127509-77127531 AGCATTTAATGTGCTTTGGGAGG - Intergenic
1056615455 9:88161536-88161558 ATCTCTTCATGTCCCTTGGGAGG - Intergenic
1059636341 9:116174540-116174562 ATCTGCTGAAGAGCATTGGGAGG - Intronic
1062323570 9:136002346-136002368 ATCCGTTCATGGGCTCTGGGTGG + Intergenic
1185667908 X:1782142-1782164 CTCTGTGAATGTTCTTTGGGAGG + Intergenic
1186924237 X:14314536-14314558 ATTTGTTGCTGGGGTTTGGGTGG - Intergenic
1187893159 X:23956228-23956250 ATTTCTTGATGGGCATTGGGGGG - Intergenic
1188812764 X:34672206-34672228 ATCTGTTGATGTGTTTTGCCGGG - Intergenic
1188974095 X:36652875-36652897 TTCTGTTGATTTGCATTTGGTGG - Intergenic
1192419004 X:71011884-71011906 GTCTGTGCATGTCCTTTGGGAGG + Intergenic
1193811812 X:86060512-86060534 CTCAGTTTATGTGCTTAGGGTGG - Intergenic
1194151887 X:90336146-90336168 ATCTGTTGTGGTAGTTTGGGAGG + Intergenic
1199028480 X:142969141-142969163 ATGTGTTTATGTGTTTTGTGAGG - Intergenic
1199071320 X:143478363-143478385 AAGTGTTGTTGTGCTGTGGGTGG - Intergenic
1199449809 X:147966624-147966646 ATCTGTTCATGTACTTTGCCTGG - Intergenic
1200288005 X:154843106-154843128 ATCTGTTCATGTCCTTTGTAGGG - Intronic
1200498247 Y:3912912-3912934 ATCTGTTGTGGTAGTTTGGGAGG + Intergenic