ID: 978556324

View in Genome Browser
Species Human (GRCh38)
Location 4:109984610-109984632
Sequence TGAACACAGATCAGTATTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978556324_978556325 -6 Left 978556324 4:109984610-109984632 CCAATAATACTGATCTGTGTTCA 0: 1
1: 0
2: 2
3: 12
4: 158
Right 978556325 4:109984627-109984649 TGTTCAGTTGAAAAAAATCCAGG No data
978556324_978556326 3 Left 978556324 4:109984610-109984632 CCAATAATACTGATCTGTGTTCA 0: 1
1: 0
2: 2
3: 12
4: 158
Right 978556326 4:109984636-109984658 GAAAAAAATCCAGGTATAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978556324 Original CRISPR TGAACACAGATCAGTATTAT TGG (reversed) Intronic
907295854 1:53453646-53453668 AGAACAAAGGTCAGTACTATTGG + Intergenic
909424777 1:75510429-75510451 TGAAGACAGAGCAGTGATATGGG + Intronic
910768897 1:90810912-90810934 TGAACAGAGAGCAGTGTGATGGG - Intergenic
910882001 1:91930111-91930133 AGAACACAGATCATCATGATGGG + Intergenic
914738594 1:150443355-150443377 TGAATACAGATAAATCTTATTGG - Intronic
916778818 1:168000272-168000294 TGATCACAGATCACCATAATAGG + Intronic
916846191 1:168652841-168652863 AGAAGAGAGATCAGTATTAAAGG - Intergenic
918744549 1:188183037-188183059 TGAAAGCACACCAGTATTATTGG - Intergenic
920240715 1:204547315-204547337 TCCACACAGATTAGTATTAATGG + Intronic
920834821 1:209501037-209501059 TGAACAAATATTTGTATTATGGG - Intergenic
921485181 1:215706664-215706686 TGAACATATTTCAGTATAATAGG + Intronic
921896621 1:220407962-220407984 TGAAGACAGATCAGCATGAGTGG - Intergenic
924075784 1:240335045-240335067 TGATTACAGATCAGTATCTTTGG - Intronic
924311390 1:242747050-242747072 TAAAGACAGATCGGTATTATTGG + Intergenic
1064383698 10:14870904-14870926 TGAGCACAGATCAGTTTCTTAGG - Intronic
1068466340 10:57398112-57398134 TAAACACAAATCAGTTTTCTTGG - Intergenic
1068483889 10:57631340-57631362 ATAACACATATCAATATTATAGG - Intergenic
1068498811 10:57818029-57818051 TGAACCCAGAGCAGTATAAATGG + Intergenic
1068970970 10:62957977-62957999 AGAAAACAAATCAGTATTATTGG + Intergenic
1069253193 10:66297903-66297925 TGAAAGCAGATGAGTATAATAGG + Intronic
1070421123 10:76238412-76238434 GGAACAAAGATGAGTATTACAGG - Intronic
1071345640 10:84689261-84689283 TAAACACAGATCACTTCTATGGG - Intergenic
1071754223 10:88518515-88518537 TGAATAAATATCAGTATAATTGG + Intronic
1078334777 11:10455000-10455022 TGTGCACAGAGCAGTATTACAGG - Intronic
1078575191 11:12496029-12496051 TTAAAACAGATAAGTATGATTGG + Intronic
1079700940 11:23546441-23546463 TGAAGACAGATCAATAAAATAGG - Intergenic
1081607086 11:44533996-44534018 TGAAAACAAAACAGTGTTATTGG + Intergenic
1086678978 11:89645285-89645307 TTAATAGAAATCAGTATTATTGG + Intergenic
1088165935 11:106937270-106937292 TGAGCACAGTTCCTTATTATTGG + Intronic
1088602820 11:111497689-111497711 TGATAACAGATAAGTGTTATAGG - Intronic
1089544275 11:119210908-119210930 TGTACACGGTTCAGTACTATTGG - Intronic
1090846687 11:130535379-130535401 TGAACACAGACAAGCGTTATGGG - Intergenic
1091183054 11:133624757-133624779 TGGACAGAGATCTGAATTATTGG + Intergenic
1093904201 12:24670762-24670784 AGAACAGAGATCAGGATAATTGG - Intergenic
1096597851 12:52708370-52708392 TCAACTCAGATCAATATTAGTGG + Intergenic
1101707771 12:107236642-107236664 GCAACAAAGATCATTATTATTGG + Intergenic
1105929151 13:25035496-25035518 TAAACACATATCACTATGATTGG + Intergenic
1107711762 13:43157504-43157526 TTCCCAAAGATCAGTATTATAGG - Intergenic
1108999827 13:56785028-56785050 TAAACACAGATAAGTATTTTAGG - Intergenic
1109866076 13:68265474-68265496 TGAAAACAGATCATCAATATGGG - Intergenic
1110164258 13:72419345-72419367 TGGAAATAGAGCAGTATTATGGG + Intergenic
1110565978 13:76957880-76957902 TTAACACAGAACAGTCTTCTAGG - Exonic
1112793380 13:103028480-103028502 TGAACACACATCACTATGGTTGG + Intergenic
1113663276 13:112121705-112121727 TGACCACATAACAGTTTTATGGG - Intergenic
1113723800 13:112582210-112582232 TAAACACTGAACAGTATTTTGGG - Intronic
1115468606 14:33744463-33744485 TGATCACAGATCACTATAACAGG + Intronic
1116520048 14:45835733-45835755 TTATCACAGCTCAGTAATATTGG + Intergenic
1117832962 14:59771352-59771374 TGCACACAGTTCAGACTTATGGG - Intronic
1121028878 14:90640660-90640682 TGAACATACTTCAGTAGTATTGG + Intronic
1123146161 14:106132598-106132620 TGAACGCATTTCAGTAGTATGGG - Intergenic
1126900866 15:53313245-53313267 TGCCCACAGTTCAGAATTATAGG + Intergenic
1127258367 15:57309691-57309713 GGAACATAGATCAGAATTTTTGG - Intergenic
1127825632 15:62700272-62700294 TGAACATAGATGAGTATTTTTGG + Intronic
1130041928 15:80412374-80412396 TCAACACAGATCTTTATTGTGGG - Intronic
1130666859 15:85877092-85877114 AGAACACAGAGGGGTATTATTGG + Intergenic
1135128778 16:19834570-19834592 TGACCACAGACCACTAGTATAGG + Intronic
1139571238 16:67814008-67814030 TGAACACTGAACAGAAGTATAGG + Intronic
1139837231 16:69848972-69848994 TGAAAACATATCAGATTTATTGG + Intronic
1140459421 16:75127001-75127023 TTAAGTCAGATCAGAATTATAGG - Intergenic
1143760059 17:9095560-9095582 AGAACACAGATGTGTATCATTGG - Intronic
1146108474 17:30064533-30064555 TGAACAAATATTTGTATTATGGG + Intronic
1146517944 17:33503892-33503914 TGAACTCAGATCAATATTATGGG - Intronic
1148854941 17:50573668-50573690 TGATCACTGATCAGAATTTTGGG - Intronic
1149164362 17:53733081-53733103 TAAGCACAGGTCAGTATTAAAGG + Intergenic
1149254186 17:54806395-54806417 GGAATACATATCAGTATTAGTGG - Intergenic
1149472625 17:56930584-56930606 TTAAGTCATATCAGTATTATAGG - Intergenic
1149479119 17:56987282-56987304 TGGACACACATCAGTTTTCTTGG - Intronic
1153832284 18:8934522-8934544 TGAACACAGATGAGGAGTTTAGG + Intergenic
1153892539 18:9531516-9531538 TGCACACAGGTCCGAATTATAGG + Intronic
1154477248 18:14774202-14774224 TAAATACTGATCAGCATTATAGG + Intronic
1156073259 18:33238648-33238670 TGAACATACATTTGTATTATGGG + Intronic
1157713743 18:49867781-49867803 GGAACACGGATCAGTTTTACTGG - Intronic
1157765630 18:50294926-50294948 TGAACACAGACCAGTACCAAAGG - Intergenic
1159045181 18:63363100-63363122 TGAACTCAGAAAAATATTATAGG - Intronic
1162213122 19:9109104-9109126 GGAACACAGATTATTATTACTGG - Intergenic
1165209504 19:34222649-34222671 TGGAAAGAGATCAGTATTAGTGG + Intronic
1167654950 19:50757681-50757703 AGAAAAAAGAACAGTATTATTGG + Intergenic
925087406 2:1118783-1118805 TGAAGAAAGTTCTGTATTATGGG + Intronic
925954266 2:8946670-8946692 TGATCACAGATCACTATAACAGG - Intronic
927074929 2:19567989-19568011 CGAAGACAGATCAGTATTTTTGG - Intergenic
927327839 2:21826578-21826600 TGCACACATATGTGTATTATAGG - Intergenic
928940835 2:36725749-36725771 TGAACACAGATCATCAATTTAGG - Intronic
931310679 2:61076791-61076813 TGAACACAAATCAGTTTTATAGG - Intronic
931365775 2:61617565-61617587 AAAACACAGAACAGTATTATGGG - Intergenic
932922693 2:75935489-75935511 TAAACACAGATCAGCATTCCTGG - Intergenic
935596557 2:104883164-104883186 TGAACACAGATCAGAAATGCAGG - Intergenic
935951408 2:108332570-108332592 TGAAGTCAAACCAGTATTATAGG + Intergenic
945627234 2:212225836-212225858 TGAACACAGAGCAGGATTCTTGG - Intronic
946598608 2:221334358-221334380 TGAACAGATATCAGATTTATGGG - Intergenic
947214373 2:227736603-227736625 AGAACCCAGATCATAATTATTGG - Intergenic
947916992 2:233839229-233839251 TGGACACAGACCAGTCTCATGGG - Intronic
1169069882 20:2718949-2718971 TGAAAACATATCAGAATTTTGGG - Intronic
1173051812 20:39570611-39570633 TGAACAAATATTTGTATTATAGG - Intergenic
1173729472 20:45318320-45318342 AGGACACAGATAAGTATCATGGG + Intergenic
1177165499 21:17598587-17598609 TGAAAACAGCTCAGTTTTAAAGG - Intronic
1177907974 21:26994900-26994922 AGAACACAGTTCAGTATTTGGGG - Intergenic
1178562365 21:33650869-33650891 TGAGAATAGATCTGTATTATAGG + Intronic
1179366336 21:40761443-40761465 TGAACACAGATGTGTACTACAGG + Intronic
1184377775 22:44125357-44125379 TGAAGAAAGAGAAGTATTATGGG + Intronic
949411835 3:3774033-3774055 TGATCACAGATCACTGTAATAGG - Intronic
950405079 3:12799087-12799109 TGAAAACACAGTAGTATTATTGG + Intronic
951643687 3:24864134-24864156 TGCTCACAGTTCAGTGTTATGGG - Intergenic
952371541 3:32727543-32727565 AAAACTCAGATCAGGATTATTGG + Intronic
953391652 3:42537240-42537262 TGAACTCAGATCTGTCTGATAGG + Exonic
959154686 3:102652634-102652656 GGAACACAGGGCAGCATTATAGG + Intergenic
959212317 3:103401846-103401868 TGGACACTGATCATCATTATGGG + Intergenic
960657351 3:120020512-120020534 TGATCACAGATCACCATAATGGG - Intronic
962033467 3:131625958-131625980 TGATCACAGATCACCATAATAGG - Intronic
965750703 3:171971971-171971993 TGAACCCAGTCCAGTATTGTTGG - Intergenic
966621346 3:181967651-181967673 TGAGCAGAGATCAGTGCTATAGG + Intergenic
966850510 3:184162143-184162165 TGAGCATAAATGAGTATTATGGG - Intronic
971046184 4:22807588-22807610 TGAACACAGATAAGTTTTAGGGG - Intergenic
976125070 4:81825366-81825388 TGAATACAAATTTGTATTATGGG - Intronic
976297863 4:83489525-83489547 TTAACAGAGATGAATATTATTGG - Intronic
976439443 4:85056295-85056317 TGAATAGAGATTATTATTATCGG - Intergenic
976834260 4:89352545-89352567 TGAACATAGCTCATTATTTTTGG + Intergenic
977595533 4:98875258-98875280 AAATCACAGATCAGTATTTTGGG + Intronic
977612905 4:99054927-99054949 TGATCACAGATCACTATAACTGG + Intronic
978331897 4:107622261-107622283 TGAAGACAGAGCAGTACTCTTGG - Intronic
978556324 4:109984610-109984632 TGAACACAGATCAGTATTATTGG - Intronic
979613332 4:122713072-122713094 TAAACACATATCACTATGATTGG - Intergenic
980766248 4:137309305-137309327 TGAATACATATTAGTATTAATGG + Intergenic
981241210 4:142478098-142478120 TGCACACAAATCAGTAGAATTGG - Intronic
981706676 4:147666802-147666824 TAAACAAAGTTCAGCATTATGGG - Intronic
983722243 4:170869917-170869939 TGAAAACACAACAGTATTTTAGG - Intergenic
984256659 4:177397720-177397742 TGAAGACAGATCATTTTGATCGG - Intergenic
985342410 4:188969171-188969193 TTAACACACCTCAGTATTAAAGG + Intergenic
986017061 5:3766493-3766515 TGAAGACATATCAGTAACATGGG + Intergenic
991145885 5:63303127-63303149 TGAACAAAGATTACTATTATTGG - Intergenic
992050966 5:72940649-72940671 AGAACACAAATCAGAAATATAGG + Intergenic
994712188 5:103279417-103279439 TGATCACAGATGGGCATTATAGG - Intergenic
995292360 5:110471271-110471293 TGAACAAACATTTGTATTATGGG + Intronic
997176195 5:131780622-131780644 TGATCACAGATCACCATAATAGG - Intronic
997406772 5:133655219-133655241 TGAACACAGATAGTAATTATGGG - Intergenic
997921023 5:137979427-137979449 TGTACCCAGATCTGTATTTTAGG - Intronic
999894749 5:156019524-156019546 TGAATAAAGATCAGTAATTTTGG + Intronic
1001075979 5:168628432-168628454 TGAACTTAGATCAGTTTTAGTGG + Intergenic
1002561403 5:180084593-180084615 TGAAGACAGGCCAGTATTATGGG + Intergenic
1004741858 6:18469499-18469521 TGATCAAAGATCTGTATTATTGG - Intergenic
1007884220 6:45207674-45207696 TGATCACAGATCACTATAACAGG - Intronic
1008845186 6:55954528-55954550 TGAACACACATCTATATTTTAGG - Intergenic
1009055314 6:58327984-58328006 TCAAACCATATCAGTATTATTGG - Intergenic
1009438222 6:63643043-63643065 AGAACAGAGATTATTATTATTGG + Intronic
1012788027 6:103657371-103657393 TGAACACAGATTAATACAATAGG - Intergenic
1012965080 6:105665406-105665428 TGACCACAGATCACTATAACAGG + Intergenic
1016145144 6:140661876-140661898 TGAACTAAGATCACTATTCTTGG + Intergenic
1016469378 6:144359600-144359622 TGAAGACAAAACAGTATTTTGGG - Intronic
1016653851 6:146495062-146495084 TGAAAACAGATTAATATTGTCGG + Intergenic
1017612108 6:156198566-156198588 TGAACACAGATCTGTATACTGGG + Intergenic
1018549589 6:164980472-164980494 TTAACTCAGATCAGTTTTCTAGG - Intergenic
1021376578 7:19915267-19915289 TGATCACAGATCACCATAATAGG + Intergenic
1022122932 7:27327276-27327298 TGAACTCAGTTAAGTTTTATTGG + Intergenic
1022860826 7:34364756-34364778 AGAAGGCAGATGAGTATTATAGG + Intergenic
1023627011 7:42125723-42125745 TGAGGACAGCTCTGTATTATGGG - Intronic
1028613427 7:92737732-92737754 TGCACACAGTTCAGCATTAATGG - Intronic
1029581779 7:101441112-101441134 CGAACACAAATTAGTATTACTGG + Intronic
1032651324 7:133881791-133881813 TGAAGACATAGCAGTATTGTTGG - Intronic
1034544011 7:151777846-151777868 AGACCACAGATTAGGATTATGGG + Intronic
1035025655 7:155823689-155823711 TGAAAACACATCATTATTAGTGG - Intergenic
1036012956 8:4748546-4748568 AGAACAGACATCAGGATTATTGG + Intronic
1037912695 8:22753511-22753533 TGAAATCAGATCAGTGATATTGG + Intronic
1041484572 8:58360261-58360283 TGAACAAAAATCTGTGTTATAGG + Intergenic
1042170684 8:65988205-65988227 TAAACAAAGATCAGGATAATTGG + Intergenic
1043115167 8:76242311-76242333 TGAAAACAGATCATCTTTATTGG + Intergenic
1043153594 8:76749045-76749067 TGAACTAAAATCAGTATTAAAGG + Intronic
1044628034 8:94253799-94253821 TGAACACAGTACAGTACAATGGG + Intronic
1045391820 8:101722734-101722756 TGCACACAGATCAGTCTCAGTGG - Intronic
1048169556 8:132092870-132092892 AGAACACAGATCATTATGAAAGG + Intronic
1057023734 9:91720266-91720288 TGCACACTGATCACTATTTTTGG - Intronic
1059607239 9:115847012-115847034 TGAACAGAGATCAATTTTGTAGG - Intergenic
1191818593 X:65276212-65276234 TGAACAAATATTTGTATTATGGG + Intergenic
1192054289 X:67757752-67757774 TCAACACAGATGAGGAATATTGG + Intergenic
1196164904 X:112528096-112528118 TGAACATAGCTCTGTATTCTAGG + Intergenic