ID: 978562303

View in Genome Browser
Species Human (GRCh38)
Location 4:110046069-110046091
Sequence CTGTCTAGACATATTCAGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 106}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978562303_978562307 7 Left 978562303 4:110046069-110046091 CCTGCCTGAATATGTCTAGACAG 0: 1
1: 0
2: 0
3: 16
4: 106
Right 978562307 4:110046099-110046121 TGTTTGAAACGAGTATGACCAGG 0: 1
1: 0
2: 0
3: 9
4: 64
978562303_978562309 11 Left 978562303 4:110046069-110046091 CCTGCCTGAATATGTCTAGACAG 0: 1
1: 0
2: 0
3: 16
4: 106
Right 978562309 4:110046103-110046125 TGAAACGAGTATGACCAGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 59
978562303_978562308 8 Left 978562303 4:110046069-110046091 CCTGCCTGAATATGTCTAGACAG 0: 1
1: 0
2: 0
3: 16
4: 106
Right 978562308 4:110046100-110046122 GTTTGAAACGAGTATGACCAGGG 0: 1
1: 0
2: 0
3: 3
4: 88
978562303_978562310 20 Left 978562303 4:110046069-110046091 CCTGCCTGAATATGTCTAGACAG 0: 1
1: 0
2: 0
3: 16
4: 106
Right 978562310 4:110046112-110046134 TATGACCAGGGAGGACTGTTAGG 0: 1
1: 0
2: 0
3: 24
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978562303 Original CRISPR CTGTCTAGACATATTCAGGC AGG (reversed) Exonic
900252993 1:1681162-1681184 CTCACTAGACAGTTTCAGGCCGG - Intronic
904702493 1:32366193-32366215 CTGTCCATACATAAGCAGGCAGG - Intronic
915795157 1:158723918-158723940 CTGTCTAGACTTATACAGGTGGG - Intergenic
918075692 1:181169767-181169789 CTGTCTAAACATCATCAGGAGGG - Intergenic
918086917 1:181253291-181253313 CTGTATAGGAATATTCAGGCTGG - Intergenic
918703139 1:187630801-187630823 ATGCCTAGGCATATTCAGACAGG - Intergenic
1065516420 10:26528497-26528519 CAGTCTAGAGATTTTCAGGAAGG - Intronic
1070955284 10:80459640-80459662 CTGTCAACGCATAGTCAGGCAGG - Intronic
1071853022 10:89594565-89594587 CTTTCTAGAAATATTCAAGGAGG - Intronic
1076696551 10:132249972-132249994 CTGTTTTGACAGATTCCGGCTGG - Intronic
1077889054 11:6405612-6405634 CTGACGAGAGTTATTCAGGCAGG + Intronic
1082312438 11:50668796-50668818 CTGTGAAGACATATTAAGGAGGG - Intergenic
1082735290 11:56848284-56848306 CTGTCTAGACATTTTTTAGCTGG - Intergenic
1084224117 11:67704363-67704385 CTGTATAGGAATAGTCAGGCTGG - Intergenic
1087269269 11:96094886-96094908 CTACCTAGAAATCTTCAGGCAGG - Intronic
1087680375 11:101213257-101213279 CTGTATAGGAATAGTCAGGCTGG + Intergenic
1087687214 11:101278715-101278737 GTATCTAGAAATATTCAGTCTGG + Intergenic
1087841695 11:102927402-102927424 CTGGCTAGACATATACAGTCTGG - Intergenic
1092247110 12:6869808-6869830 CTGTCCAAACCTATTGAGGCAGG - Intronic
1098786565 12:74765558-74765580 CTCTTTAGAAATATTAAGGCCGG + Intergenic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1106002421 13:25736826-25736848 CTGTCTGGACATATTCACACAGG - Intronic
1106700763 13:32225952-32225974 CTGTATAGAGATATTCAGGTTGG - Exonic
1106826361 13:33525688-33525710 CTGTCTTGGCATATTCCGTCTGG + Intergenic
1110005822 13:70267121-70267143 GTGTATAGAAATATTCAGACAGG + Intergenic
1111121630 13:83859172-83859194 CTGCCTAGACACCTTCAGCCAGG + Intergenic
1111259298 13:85714555-85714577 CTTTCTGGACATATTCATGGGGG + Intergenic
1111693480 13:91593360-91593382 CTGACTAGACATACCCAGGAAGG - Intronic
1115648376 14:35385564-35385586 CTGTCTAGACCCATCCAGGCAGG + Intergenic
1116771636 14:49132768-49132790 CTGTCTCCTCATTTTCAGGCTGG - Intergenic
1119014534 14:71036472-71036494 GTATCTAAACATATACAGGCTGG - Intronic
1121764661 14:96475668-96475690 CTGTTTTGACATCTTCAGGGGGG - Intronic
1126072478 15:44876956-44876978 CTGTCTGAACATACTCACGCAGG + Intergenic
1127408111 15:58674891-58674913 AGGTATAGACAAATTCAGGCCGG + Intronic
1129237056 15:74229997-74230019 GTGTCTTGAATTATTCAGGCTGG + Intergenic
1139157946 16:64466949-64466971 CTGGCTAGCCATATGCAGGAAGG + Intergenic
1142513377 17:411629-411651 GTGTGTAGTCATATGCAGGCAGG + Intronic
1149777392 17:59368929-59368951 CTGTTTAAAAATAGTCAGGCTGG + Intronic
1156453377 18:37279212-37279234 CTCTGAAGACACATTCAGGCAGG + Intronic
1156812906 18:41274082-41274104 CTGCCTGGACATAGGCAGGCTGG - Intergenic
1157756435 18:50222159-50222181 CTGTATAGGAATAGTCAGGCTGG + Intergenic
925250362 2:2430322-2430344 CAGCCTAGAAATTTTCAGGCTGG + Intergenic
927715273 2:25347841-25347863 CTGTTCAGACTAATTCAGGCTGG - Intergenic
928672639 2:33618159-33618181 CTGTCCAAGCATACTCAGGCAGG - Intergenic
929121424 2:38487170-38487192 CTGTTTAAACATAATCAGGCTGG + Intergenic
929129510 2:38553293-38553315 CTGGCCAGAAATATTCAGGCAGG + Intergenic
933985480 2:87588322-87588344 CTGTCTAGAGATCTTGAGACTGG - Intergenic
936308361 2:111362479-111362501 CTGTCTAGAGATCTTGAGACTGG + Intergenic
939358269 2:141133099-141133121 CTGGCTAGACATTCTCAGTCGGG - Intronic
939932410 2:148252265-148252287 GTGTCTAGCTATGTTCAGGCTGG - Intronic
940693996 2:156956176-156956198 CTGTGCAGAGATATTCATGCAGG - Intergenic
945139385 2:206667563-206667585 CTGTCTAGAAATTTGAAGGCTGG - Intronic
945723514 2:213447677-213447699 CTGTATAGGAATAGTCAGGCTGG - Intronic
946236659 2:218328472-218328494 CTGTGTAGCCATATTCTGGTTGG - Intronic
947688567 2:232113446-232113468 CTGTCTAAGCATATTCATGCAGG - Intronic
1170647150 20:18207737-18207759 CTGTCTATAGAAATTCAGGGAGG - Intergenic
1177642326 21:23859192-23859214 CTCTGTAGAGATATTCAGGCAGG + Intergenic
1180081184 21:45488490-45488512 CTGTCTCGACATCTTGGGGCTGG + Intronic
1183686904 22:39366347-39366369 CTTTCAAAATATATTCAGGCCGG + Intronic
952774384 3:37030623-37030645 TTGTCTAAGCAAATTCAGGCAGG + Intronic
953720078 3:45347583-45347605 CTGTCAGGAAAGATTCAGGCTGG + Intergenic
962050240 3:131806070-131806092 CTGTGCAGCCATATTCAGGCAGG + Intronic
964354923 3:155841245-155841267 TTGTTTTGCCATATTCAGGCTGG + Intronic
966402935 3:179564994-179565016 CTGTTAAGACATATTCTGACTGG - Intronic
968868117 4:3226874-3226896 ATGTCTAGAAAAATACAGGCTGG - Intronic
970228062 4:13880311-13880333 CAGTCCAGACATATTCAGGAGGG + Intergenic
971483660 4:27138210-27138232 CTGTTTAAACATATTCAGATAGG - Intergenic
975615504 4:76242490-76242512 CTCTAAAGAAATATTCAGGCTGG - Intronic
978562303 4:110046069-110046091 CTGTCTAGACATATTCAGGCAGG - Exonic
979204977 4:118028245-118028267 CTATCTTGTAATATTCAGGCAGG - Intergenic
987364240 5:17134534-17134556 CTGTATAAGAATATTCAGGCCGG - Intronic
990370060 5:55108845-55108867 CTGGCTGGAAATATTCAGCCAGG - Intronic
992199198 5:74367530-74367552 CTGTCTGGACAAAGTCTGGCAGG + Intergenic
992507453 5:77401200-77401222 CTTTCTAGACATGAACAGGCTGG + Intronic
996843348 5:127872568-127872590 CTGGATGGACATCTTCAGGCAGG - Intergenic
997099823 5:130956956-130956978 CTGACTAGCCATATGCAGACTGG - Intergenic
998055255 5:139070360-139070382 CTGCCTATTCATATTCCGGCTGG - Intronic
1000187932 5:158878951-158878973 CTGTGTAAACAAATTTAGGCTGG - Intronic
1002518139 5:179774441-179774463 CGGGCTAGACATTTTCAGGTGGG - Exonic
1003016835 6:2474894-2474916 ATGTCTAGCAATATTCACGCAGG + Intergenic
1005893591 6:30159961-30159983 GTGTTTACATATATTCAGGCTGG - Intronic
1009717098 6:67411988-67412010 CTGTCTGAACATATTCAAGCAGG - Intergenic
1012563817 6:100620571-100620593 CTGTCTATAGATATTTGGGCTGG - Intronic
1012682307 6:102197309-102197331 CTGACTAGAATTTTTCAGGCTGG + Intergenic
1012852600 6:104464954-104464976 ATGTCAAGACATTCTCAGGCTGG - Intergenic
1017563780 6:155662562-155662584 CTGTCTACACATAGTCATGCAGG + Intergenic
1021952320 7:25787256-25787278 CTCACTTGACATATTCAGACTGG + Intergenic
1024484633 7:49904107-49904129 CTGACTAGACATGTTCAAGATGG - Intronic
1026067975 7:67092440-67092462 TTCCCTAGACATAATCAGGCAGG + Intronic
1026708953 7:72719866-72719888 TTCCCTAGACATAATCAGGCAGG - Intronic
1029841539 7:103369589-103369611 CTGTCAAGGCATATTTATGCAGG + Intronic
1034860132 7:154587790-154587812 CTGCCGAGACATAGTCACGCAGG - Intronic
1035980667 8:4367264-4367286 CTGTCTAGACTCATGCAGTCTGG - Intronic
1038559920 8:28565807-28565829 CTGTCCAGACTTATTCAGATTGG - Exonic
1039169906 8:34732232-34732254 CTGTTCAGACATATTAAAGCAGG + Intergenic
1045472049 8:102521243-102521265 CTGTATACACACATTAAGGCTGG - Intergenic
1046204505 8:110975290-110975312 CTTTCTAAACAGATTCAAGCAGG - Intergenic
1046414891 8:113899852-113899874 CTGTCTATACATTTTCAGTTAGG - Intergenic
1047684646 8:127292680-127292702 CTGTTTAGACAAATTCTGTCTGG + Intergenic
1048085580 8:131174820-131174842 CTGTTTACACATATTCAGTAAGG + Intergenic
1048862240 8:138732153-138732175 CTTTCTAGACATTTTTTGGCGGG - Intronic
1055416348 9:76088082-76088104 CTGTCTAAACATCCTCAGACTGG - Intronic
1057263836 9:93601239-93601261 CTGTCTGCACATATACAGCCAGG + Intronic
1057521191 9:95761883-95761905 TTGTCTAGAAGTATCCAGGCCGG - Intergenic
1058151119 9:101464742-101464764 CTGTTTACACTTATTCAGGCTGG + Intergenic
1059198542 9:112393898-112393920 CTGTATAGGAATAGTCAGGCTGG + Intronic
1190713688 X:53087229-53087251 CAATCTAGACATGTTCAGGTAGG + Intronic
1193077720 X:77373275-77373297 CTGTCGACACATGTACAGGCAGG + Intergenic
1193584411 X:83303112-83303134 CTGTCTAGACAAATTTTGGATGG + Intergenic
1194983398 X:100463256-100463278 CTGTGTATTCATATTGAGGCTGG - Intergenic
1199000679 X:142632748-142632770 CTGTCTATGCATATTCATACAGG + Intergenic
1202278835 Y:23155592-23155614 CAGTCTAGAAATATTCTGACAGG - Intronic
1202279136 Y:23160371-23160393 CAGTCTAGAAATATTCTGACAGG - Intronic
1202285298 Y:23236459-23236481 CAGTCTAGAAATATTCTGACAGG + Intronic
1202285601 Y:23241237-23241259 CAGTCTAGAAATATTCTGACAGG + Intronic
1202285904 Y:23246017-23246039 CAGTCTAGAAATATTCTGACAGG + Intronic
1202286369 Y:23253172-23253194 CAGTCTAGAAATATTCTGACAGG + Intronic
1202431659 Y:24786932-24786954 CAGTCTAGAAATATTCTGACAGG - Intronic
1202431962 Y:24791689-24791711 CAGTCTAGAAATATTCTGACAGG - Intronic
1202432265 Y:24796445-24796467 CAGTCTAGAAATATTCTGACAGG - Intronic
1202437701 Y:24861693-24861715 CAGTCTAGAAATATTCTGACAGG + Intronic
1202438003 Y:24866473-24866495 CAGTCTAGAAATATTCTGACAGG + Intronic
1202438306 Y:24871230-24871252 CAGTCTAGAAATATTCTGACAGG + Intronic