ID: 978566654

View in Genome Browser
Species Human (GRCh38)
Location 4:110089795-110089817
Sequence CAGCCCTGAGGTCTTTCCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 123}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978566654_978566663 18 Left 978566654 4:110089795-110089817 CCAACGGAAAGACCTCAGGGCTG 0: 1
1: 0
2: 2
3: 19
4: 123
Right 978566663 4:110089836-110089858 GGTGATGATGGAGGTGGGGAAGG 0: 1
1: 4
2: 114
3: 1106
4: 5202
978566654_978566664 30 Left 978566654 4:110089795-110089817 CCAACGGAAAGACCTCAGGGCTG 0: 1
1: 0
2: 2
3: 19
4: 123
Right 978566664 4:110089848-110089870 GGTGGGGAAGGAAAAGAAAGAGG No data
978566654_978566662 14 Left 978566654 4:110089795-110089817 CCAACGGAAAGACCTCAGGGCTG 0: 1
1: 0
2: 2
3: 19
4: 123
Right 978566662 4:110089832-110089854 CAATGGTGATGATGGAGGTGGGG 0: 1
1: 0
2: 2
3: 59
4: 552
978566654_978566660 12 Left 978566654 4:110089795-110089817 CCAACGGAAAGACCTCAGGGCTG 0: 1
1: 0
2: 2
3: 19
4: 123
Right 978566660 4:110089830-110089852 CACAATGGTGATGATGGAGGTGG No data
978566654_978566661 13 Left 978566654 4:110089795-110089817 CCAACGGAAAGACCTCAGGGCTG 0: 1
1: 0
2: 2
3: 19
4: 123
Right 978566661 4:110089831-110089853 ACAATGGTGATGATGGAGGTGGG 0: 1
1: 0
2: 2
3: 46
4: 299
978566654_978566656 -3 Left 978566654 4:110089795-110089817 CCAACGGAAAGACCTCAGGGCTG 0: 1
1: 0
2: 2
3: 19
4: 123
Right 978566656 4:110089815-110089837 CTGCATAATCACAGCCACAATGG 0: 1
1: 0
2: 1
3: 12
4: 164
978566654_978566658 9 Left 978566654 4:110089795-110089817 CCAACGGAAAGACCTCAGGGCTG 0: 1
1: 0
2: 2
3: 19
4: 123
Right 978566658 4:110089827-110089849 AGCCACAATGGTGATGATGGAGG No data
978566654_978566657 6 Left 978566654 4:110089795-110089817 CCAACGGAAAGACCTCAGGGCTG 0: 1
1: 0
2: 2
3: 19
4: 123
Right 978566657 4:110089824-110089846 CACAGCCACAATGGTGATGATGG 0: 1
1: 0
2: 0
3: 17
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978566654 Original CRISPR CAGCCCTGAGGTCTTTCCGT TGG (reversed) Intronic
900582479 1:3415904-3415926 CAGGGCTGAGGTCTTTCCACAGG - Intronic
901124165 1:6917586-6917608 CAGCCCTGAGGTCTCTGTTTTGG + Intronic
901632286 1:10653732-10653754 CAGCCCCGAGATCTTGCTGTTGG + Exonic
912382035 1:109252971-109252993 CATCCCTGAGGTCTTTCAGCTGG + Exonic
912458728 1:109817388-109817410 CAGGCCTGAGGACTTTACATTGG - Intergenic
913218821 1:116643317-116643339 CAGCCCTGGGGCAGTTCCGTTGG - Intronic
914003090 1:143709172-143709194 GAGCCCTGGGGACTTTCCTTAGG + Intergenic
914909852 1:151776100-151776122 GAGCCCTGAGGTCCTTCAGTGGG + Exonic
918247680 1:182674210-182674232 CAGCCCTGCTCTCTTTCCTTGGG - Intronic
919867228 1:201791659-201791681 CAGGCCTGGGGTCTATCCGTCGG + Intronic
920735146 1:208526887-208526909 CAGCCCTGAGGCCTTTCTTGGGG + Intergenic
921120622 1:212133534-212133556 CAGCCCAGATGTCCTTCAGTGGG + Intergenic
923045771 1:230354660-230354682 CTGCCCTGAGGCCTCTCCCTGGG + Intronic
923912543 1:238464646-238464668 CAGCCTTGTGGGCTTTCTGTTGG + Intergenic
1065360607 10:24885739-24885761 CAACCCAGAGGTCCTTCAGTAGG + Intronic
1073132668 10:101200258-101200280 CAGCCCTTGGAACTTTCCGTAGG - Intergenic
1073658209 10:105441205-105441227 CAGCCCCAAGGTCTTACAGTTGG - Intergenic
1076739965 10:132478177-132478199 CAGCCCTGAGGTCTAGCAGGGGG + Intergenic
1076871449 10:133196961-133196983 CAGCCCTGAGCTTTTTCAGATGG + Intronic
1078043385 11:7890293-7890315 CAGCCCAGAGGTCTCTACCTCGG - Intergenic
1083067580 11:59941312-59941334 CAGCCCAGATGTCTTTTGGTGGG - Intergenic
1083222821 11:61264670-61264692 CTGTCCTGGGATCTTTCCGTGGG - Intronic
1084507568 11:69578135-69578157 CAACCCAGATGTCTTTCAGTAGG - Intergenic
1089367696 11:117931224-117931246 CAAGCCTGAGCTCTTTCCCTAGG - Intergenic
1089439166 11:118500587-118500609 CAAACCTGAGGTGTTTCCTTTGG - Intronic
1091552231 12:1545079-1545101 CAAACCTGAGGACTTTCCTTTGG + Intronic
1093607196 12:21106837-21106859 AAGCTCTGAGGTCTTTCGTTGGG + Intronic
1096497286 12:52045873-52045895 CTGCCCTGGGGGCTTCCCGTGGG - Intronic
1105292334 13:19060972-19060994 CAGCCCTGAGCTTTTTGGGTAGG + Intergenic
1107128025 13:36865414-36865436 CAGCCCTGGGGTCCTTCCACAGG + Intronic
1107348942 13:39493792-39493814 GAGCCCTGATGTCTTTCCTGAGG - Intronic
1121122184 14:91383046-91383068 GAGCCCTGGGGTCCTTCAGTAGG - Intronic
1121250263 14:92494063-92494085 CAGCCCAGAGGTGGTTCCTTAGG + Exonic
1124138640 15:27057571-27057593 CAGCCCAGAGGCCTTTCCAGGGG - Intronic
1126339914 15:47628135-47628157 CAACCCAGATGTCTTTCAGTGGG - Intronic
1128656953 15:69469572-69469594 GAGGCCTGGGGTCTTTCCGTGGG + Intergenic
1128796453 15:70470038-70470060 CAGCCCTGAGTTCATGCTGTGGG - Intergenic
1130404084 15:83582374-83582396 GATTCCTGAGGTCTTTCCATTGG + Intronic
1132296676 15:100740271-100740293 CAGCCCAGATGTCCTTCAGTGGG - Intergenic
1132793885 16:1708799-1708821 AAGCCCTGAGGTCTTTCCAAGGG - Intronic
1133151343 16:3834348-3834370 CAACCATGAAGTCTTTCAGTAGG + Intronic
1133893661 16:9904940-9904962 CAGCACTGAGGTGTTTCCTTTGG + Intronic
1134466450 16:14482930-14482952 CAGGCCTGAGGTCTGACCCTTGG + Intronic
1135218022 16:20589731-20589753 CGGCCAGGAGGTCTTTCTGTGGG - Intergenic
1138491674 16:57380774-57380796 CAGCCCTGAGGCCTTTCCCCAGG + Intronic
1139683049 16:68580470-68580492 CAGACCTGGGGCCTTTCCATGGG + Intergenic
1140940178 16:79714061-79714083 CTGCCTTAAGGTCTTTCCATAGG - Intergenic
1141215470 16:82019583-82019605 CAGCACTGAGGTCTGTCCTCAGG - Intergenic
1203116100 16_KI270728v1_random:1491928-1491950 CAGCCCTGAGGTTTTTCCGCAGG - Intergenic
1142687434 17:1585848-1585870 CAGCTCTGGGGTCTTTCTGCAGG + Intronic
1143719416 17:8799295-8799317 CAGCCCCCAGGTCCTGCCGTTGG + Exonic
1146540953 17:33694319-33694341 AAGCCCTGATGTCTTACCCTGGG + Intronic
1147426761 17:40349498-40349520 CAGCCCTGAGGTCTTTTCCCTGG + Intronic
1147929729 17:43970965-43970987 CAGCCCTAATGTCTTTCAATGGG - Intronic
1148052741 17:44777102-44777124 CAGGCCTGAGGTCTTGGGGTGGG + Intronic
1148129063 17:45252082-45252104 CAACCCGGATGTCCTTCCGTAGG + Intergenic
1148875847 17:50686750-50686772 CAGCCCTGAGTTCTATCCGGCGG + Intronic
1149132516 17:53321938-53321960 CAGCCAAGATGTCTTTCAGTAGG + Intergenic
1150222328 17:63503201-63503223 CAGTCGTGAGGTCTTTGCGTAGG - Intronic
1151519199 17:74616334-74616356 AAGCTCTGAGGTGTTTCCATGGG + Intronic
1152228481 17:79103410-79103432 CAGCCCAGAGGTCTGTCCTAGGG + Intronic
1152292207 17:79446348-79446370 CAGCCCTGAGGTCTGACCAGGGG - Intronic
1152310986 17:79549636-79549658 CAGGCCTGAGGCCTTCCTGTGGG + Intergenic
1153831050 18:8922967-8922989 CTGCCTTGAGGCCTTTCCCTCGG - Intergenic
1155220416 18:23680272-23680294 CAGCCCTGATGACTTTTCATTGG + Intergenic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1163014086 19:14443272-14443294 CAGCCCCGAGGGGTTTCCCTGGG + Intronic
1165120600 19:33556287-33556309 GAGCCCTGAGGTCTTGTCCTTGG + Intergenic
1167032203 19:46970214-46970236 CAGCCCTAAGCTATTTCCATTGG + Intronic
925608951 2:5687670-5687692 CAGCCATGATGTCCTTCTGTAGG + Intergenic
925906204 2:8540921-8540943 GAGCCCTGGTGTCTTCCCGTAGG + Intergenic
926227467 2:10978556-10978578 CAGCCCACAGGGCTTTCCCTGGG - Intergenic
934538900 2:95159041-95159063 CAGCCCTGTGGTCCTCCCGAGGG + Intronic
938005346 2:127785721-127785743 CAACCCAGATGTCTTTCAGTAGG - Intronic
938060197 2:128248358-128248380 CAGCCAAGATGTCTTTCAGTAGG + Intronic
945956037 2:216086708-216086730 CAGCCCTGGGGTTTTCCCATTGG + Intronic
946170758 2:217893968-217893990 CAGGCCTCAGGGCTGTCCGTAGG - Intronic
946902960 2:224389962-224389984 CAGCCCTGATCTCTATCAGTTGG - Intronic
1168907114 20:1415085-1415107 CAACCCAGAAGTCTTTCAGTGGG + Intergenic
1171171678 20:23020881-23020903 CAGCCCTGAGGGCTTCTGGTTGG - Intergenic
1175616351 20:60402985-60403007 CAACCCTAAGGACATTCCGTAGG - Intergenic
1184500801 22:44870442-44870464 CAGCCCTGAGCCCTATCCTTCGG + Intergenic
1185214515 22:49590822-49590844 CAGCCCTGAGCTCTTCCCAGAGG - Intronic
1185281548 22:49972014-49972036 CTGCCCTGAGGTCAGTCAGTAGG + Intergenic
949716370 3:6936160-6936182 CAGCTCTGAGGTCTCTCCCTCGG + Intronic
950645932 3:14376793-14376815 CAGACCTGACCTCTTTCCATGGG - Intergenic
950887324 3:16373497-16373519 CAGCCCTGAGGTCTGTACCTGGG + Intronic
953423825 3:42775969-42775991 CAACCCAGATGTCTTTCAGTGGG - Intronic
953461147 3:43082039-43082061 CAGCCCTGATGTCTATGTGTTGG - Intronic
953497807 3:43403467-43403489 CTGCCCTGAGCTCTTGCTGTTGG - Intronic
956111402 3:65873292-65873314 CAGGCCTGAGAGCTTGCCGTGGG - Intronic
956467988 3:69537349-69537371 CAGCCTTGAGGTCTTTATTTGGG - Intronic
967982152 3:195072117-195072139 CAGCCCTGTGATCTTTCCTGTGG - Intronic
968138028 3:196233127-196233149 CAACCTTGTGGTCTTTCCTTCGG - Exonic
968502088 4:955548-955570 CCGCACTGAGGGCTGTCCGTGGG + Intronic
970116349 4:12700736-12700758 CAGCCCTGATATCTTGCCTTGGG - Intergenic
972848411 4:43018225-43018247 CTGCCCTCAGGTCTTTCCCTTGG - Intronic
972976265 4:44640520-44640542 CTGCACTGAGGTCCTTCCATGGG + Intronic
973001817 4:44961319-44961341 CAGCCCTGAGTTCTCTGCATGGG + Intergenic
973950906 4:56012963-56012985 TAGCCATGTGGTTTTTCCGTAGG + Intronic
978566654 4:110089795-110089817 CAGCCCTGAGGTCTTTCCGTTGG - Intronic
986429017 5:7663465-7663487 CAGTCCTGAGGTCTGTTGGTGGG - Intronic
986694497 5:10339734-10339756 CAGTCCTTAGGTCTTTCTTTTGG - Intergenic
987415312 5:17655719-17655741 CAGCCCTCAGGTCTGTGGGTCGG + Intergenic
987611821 5:20214388-20214410 CAGCTCTGTTGTCTTTGCGTAGG - Intronic
1000808322 5:165826648-165826670 CTGCCATGAGGTCTTTCCCAGGG + Intergenic
1002328751 5:178427512-178427534 CAGCCAAGATGTCTTTCAGTAGG + Intronic
1002525272 5:179812180-179812202 CAGCCTTGAGGTCTGTGCGGTGG - Intronic
1002633481 5:180595886-180595908 AGGCCCTGAGGTCTTTCAATAGG - Intergenic
1002905526 6:1445824-1445846 CAGCCCTGAGGGCTCTGCGTGGG - Intergenic
1006420985 6:33934007-33934029 CAGGACTGAGCTCTTCCCGTGGG - Intergenic
1007407699 6:41644396-41644418 AAGCCCTGTGGTTTTTCCCTGGG + Intronic
1007627689 6:43255502-43255524 CAGCTCTCAGGTCCTTCCCTGGG - Intronic
1018090688 6:160345222-160345244 CAGCCATTAGGTCTTTTCTTTGG - Intergenic
1018870779 6:167780557-167780579 CAGAGCTGAGGTCTCTCCGCCGG - Intergenic
1020211801 7:6163530-6163552 CAGCCCTGAGCCCTCTCTGTAGG + Exonic
1025005493 7:55351139-55351161 CAGCCCTGAGGGCTTTTGATTGG - Intergenic
1026085475 7:67259613-67259635 CAGCCCTGAGGGCTTCTGGTTGG - Intergenic
1026691692 7:72555260-72555282 CAGCCCTGAGGGCTTCTGGTTGG + Intergenic
1029943885 7:104511560-104511582 CAACCCAGATGTCTTTCAGTGGG + Intronic
1030826593 7:114167176-114167198 CATCCCAGATGTCTTTCAGTAGG + Intronic
1034179375 7:149126053-149126075 CAGCCCGGAGCTCAGTCCGTGGG + Intronic
1034687618 7:152986929-152986951 CATCCCTGAGGTTTTCCCCTTGG + Intergenic
1035712197 8:1726686-1726708 CAGCCAGGATGTCTTTCTGTGGG + Intergenic
1038564731 8:28610280-28610302 CAGCCCTGATCTCTTTTCCTAGG - Intronic
1042293020 8:67189358-67189380 CAGCCAAGATGTCTTTCAGTAGG + Intronic
1042807734 8:72790158-72790180 CAGCCCTGACTTCTTTCCCTGGG - Intronic
1049309084 8:141923866-141923888 GAGCCCTGAGGTCTTGCAGCTGG - Intergenic
1049432218 8:142570429-142570451 CAGCCCGGAGGTCTCCCAGTGGG - Intergenic
1053378031 9:37624900-37624922 CAGGCATGATGTCTTTCCATCGG + Intronic
1056956826 9:91089325-91089347 CACCCCTGAGGTCCTTCAGGGGG - Intergenic
1058835411 9:108855346-108855368 CAGCCCCGAGGTCTTGCCGTAGG + Exonic
1058836566 9:108862945-108862967 CAGGCCGGAGGTCCTTCCATAGG - Exonic
1059434325 9:114267078-114267100 CAGCCCTGAGTTATCACCGTGGG - Intronic
1060537267 9:124400188-124400210 CAGGCCTGAGGTCTATCCCTCGG + Intronic
1061207859 9:129174874-129174896 CCACTCTGAGGTCATTCCGTAGG + Intergenic
1061418514 9:130461134-130461156 CTGCCCTCAGGTCTTTCCAACGG + Intronic
1185873275 X:3682084-3682106 CAACCCTGAGTACTTTCCCTTGG + Intronic
1186417514 X:9396570-9396592 CAGCCCTGATGTCCTTCCATGGG - Intergenic
1187276318 X:17819113-17819135 CAGCCCTGAGGGCTGTCTGTGGG - Intronic
1195199449 X:102533382-102533404 CAGCACTGAGGTCTTTCCCAAGG - Intergenic
1199847609 X:151702386-151702408 TAGCCCTGAGGACTTGCCCTGGG + Exonic
1200039479 X:153355262-153355284 CAGTCCTGAGGTGTTTCCTCTGG + Intronic
1200791029 Y:7299054-7299076 CAACCCTGAGTACTTTCCCTTGG - Intergenic
1200835094 Y:7725241-7725263 CAGCCTTGAGGTCTATGCCTGGG + Intergenic