ID: 978569791

View in Genome Browser
Species Human (GRCh38)
Location 4:110124312-110124334
Sequence TTTGTCCAGTCCATCATTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7034
Summary {0: 1, 1: 0, 2: 34, 3: 620, 4: 6379}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978569791_978569793 3 Left 978569791 4:110124312-110124334 CCACTAATGATGGACTGGACAAA 0: 1
1: 0
2: 34
3: 620
4: 6379
Right 978569793 4:110124338-110124360 AATGTGGTATATATACACCATGG 0: 542
1: 5227
2: 28767
3: 16574
4: 9981
978569791_978569795 26 Left 978569791 4:110124312-110124334 CCACTAATGATGGACTGGACAAA 0: 1
1: 0
2: 34
3: 620
4: 6379
Right 978569795 4:110124361-110124383 AACACTATGCAGCCATAAAAAGG 0: 77
1: 2735
2: 2749
3: 3798
4: 5082

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978569791 Original CRISPR TTTGTCCAGTCCATCATTAG TGG (reversed) Intronic
Too many off-targets to display for this crispr