ID: 978569793

View in Genome Browser
Species Human (GRCh38)
Location 4:110124338-110124360
Sequence AATGTGGTATATATACACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61091
Summary {0: 542, 1: 5227, 2: 28767, 3: 16574, 4: 9981}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978569788_978569793 11 Left 978569788 4:110124304-110124326 CCAAATGCCCACTAATGATGGAC 0: 1
1: 7
2: 331
3: 4597
4: 20450
Right 978569793 4:110124338-110124360 AATGTGGTATATATACACCATGG 0: 542
1: 5227
2: 28767
3: 16574
4: 9981
978569787_978569793 12 Left 978569787 4:110124303-110124325 CCCAAATGCCCACTAATGATGGA 0: 1
1: 11
2: 429
3: 5502
4: 21955
Right 978569793 4:110124338-110124360 AATGTGGTATATATACACCATGG 0: 542
1: 5227
2: 28767
3: 16574
4: 9981
978569790_978569793 4 Left 978569790 4:110124311-110124333 CCCACTAATGATGGACTGGACAA 0: 1
1: 0
2: 26
3: 524
4: 5439
Right 978569793 4:110124338-110124360 AATGTGGTATATATACACCATGG 0: 542
1: 5227
2: 28767
3: 16574
4: 9981
978569791_978569793 3 Left 978569791 4:110124312-110124334 CCACTAATGATGGACTGGACAAA 0: 1
1: 0
2: 34
3: 620
4: 6379
Right 978569793 4:110124338-110124360 AATGTGGTATATATACACCATGG 0: 542
1: 5227
2: 28767
3: 16574
4: 9981
978569785_978569793 16 Left 978569785 4:110124299-110124321 CCAACCCAAATGCCCACTAATGA 0: 3
1: 200
2: 3818
3: 19084
4: 10172
Right 978569793 4:110124338-110124360 AATGTGGTATATATACACCATGG 0: 542
1: 5227
2: 28767
3: 16574
4: 9981

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978569793 Original CRISPR AATGTGGTATATATACACCA TGG Intronic
Too many off-targets to display for this crispr