ID: 978569795

View in Genome Browser
Species Human (GRCh38)
Location 4:110124361-110124383
Sequence AACACTATGCAGCCATAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 14441
Summary {0: 77, 1: 2735, 2: 2749, 3: 3798, 4: 5082}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978569790_978569795 27 Left 978569790 4:110124311-110124333 CCCACTAATGATGGACTGGACAA 0: 1
1: 0
2: 26
3: 524
4: 5439
Right 978569795 4:110124361-110124383 AACACTATGCAGCCATAAAAAGG 0: 77
1: 2735
2: 2749
3: 3798
4: 5082
978569791_978569795 26 Left 978569791 4:110124312-110124334 CCACTAATGATGGACTGGACAAA 0: 1
1: 0
2: 34
3: 620
4: 6379
Right 978569795 4:110124361-110124383 AACACTATGCAGCCATAAAAAGG 0: 77
1: 2735
2: 2749
3: 3798
4: 5082

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978569795 Original CRISPR AACACTATGCAGCCATAAAA AGG Intronic
Too many off-targets to display for this crispr