ID: 978572786

View in Genome Browser
Species Human (GRCh38)
Location 4:110157121-110157143
Sequence AAGGCCAAGAAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1483
Summary {0: 1, 1: 0, 2: 14, 3: 158, 4: 1310}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978572774_978572786 27 Left 978572774 4:110157071-110157093 CCAAAAGTAAATGGCCATCTGGG 0: 1
1: 0
2: 1
3: 11
4: 141
Right 978572786 4:110157121-110157143 AAGGCCAAGAAGAAGGAGGAGGG 0: 1
1: 0
2: 14
3: 158
4: 1310
978572776_978572786 13 Left 978572776 4:110157085-110157107 CCATCTGGGTCACTGCCCATTTG 0: 1
1: 0
2: 1
3: 22
4: 307
Right 978572786 4:110157121-110157143 AAGGCCAAGAAGAAGGAGGAGGG 0: 1
1: 0
2: 14
3: 158
4: 1310
978572780_978572786 -2 Left 978572780 4:110157100-110157122 CCCATTTGGGGTTCTTCTAGCAA 0: 1
1: 0
2: 1
3: 7
4: 122
Right 978572786 4:110157121-110157143 AAGGCCAAGAAGAAGGAGGAGGG 0: 1
1: 0
2: 14
3: 158
4: 1310
978572781_978572786 -3 Left 978572781 4:110157101-110157123 CCATTTGGGGTTCTTCTAGCAAG 0: 1
1: 0
2: 2
3: 9
4: 121
Right 978572786 4:110157121-110157143 AAGGCCAAGAAGAAGGAGGAGGG 0: 1
1: 0
2: 14
3: 158
4: 1310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978572786 Original CRISPR AAGGCCAAGAAGAAGGAGGA GGG Intronic
900093819 1:932304-932326 GAGGCCAGGCAGACGGAGGAGGG - Intronic
900254492 1:1690906-1690928 AAGGCAAATAAGAAGCAGGAAGG + Intronic
900263243 1:1744181-1744203 AAGGCAAATAAGAAGCAGGAAGG + Intronic
900334797 1:2157157-2157179 GAGAACAAGAAGGAGGAGGAAGG - Intronic
900522302 1:3111551-3111573 AAGGAAGAGAAGGAGGAGGAAGG + Intronic
900700782 1:4047487-4047509 AAGGGGAGGAAGGAGGAGGAAGG + Intergenic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901136705 1:7001789-7001811 AATGTCAAGAAGAAGGAAGGTGG - Intronic
901395601 1:8979000-8979022 AAGGACAAGAAGAAGTACCAAGG + Intergenic
901610438 1:10493915-10493937 AACTCCAAGAAGAGGCAGGAAGG + Intronic
901757080 1:11448024-11448046 AAGGCCAGGGAGGAGGAGGTAGG + Intergenic
902088744 1:13884935-13884957 AAGAAAAAGAAGAAGAAGGAAGG - Intergenic
902726698 1:18340953-18340975 AAGGAGAAGAAGGAGGGGGAGGG - Intronic
902960615 1:19960685-19960707 AAGGGCAAGAAGAAGGCGGCAGG - Intergenic
903445025 1:23417324-23417346 AAGGCAAAGAAGAAGGAAAAAGG - Exonic
903799465 1:25955736-25955758 GAGGGAAGGAAGAAGGAGGAAGG + Intergenic
903959445 1:27047468-27047490 CAGGCCAAGGGGAAGGAGGTGGG + Intergenic
904117258 1:28171920-28171942 AGGGCCAGGAAGAGGGAGGGAGG + Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904334737 1:29789615-29789637 AAGGACAAGGAGAAGGGAGAGGG + Intergenic
904628929 1:31827075-31827097 AAGCCCAGGAAGCAGGAGTAAGG + Intergenic
904821895 1:33250893-33250915 AAGGAGAAGAAGAAGGTGCATGG + Intergenic
905019784 1:34801071-34801093 AAGGCTCTGAAGAAGGAGGAAGG + Intronic
905051048 1:35051499-35051521 AAGGGCAAGAAGAATGGGAAAGG - Intergenic
905260235 1:36712130-36712152 AAGGAGAAGAAAGAGGAGGAAGG - Intergenic
905319102 1:37103126-37103148 AAAGACAAGAAGGAGGAAGAGGG + Intergenic
905696674 1:39979757-39979779 AAGGGCAAGAAGAAGAGGGCAGG - Intergenic
906180817 1:43817339-43817361 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906261925 1:44399102-44399124 AAGGCCCTGAAGGAGGAGCAAGG - Intergenic
906291870 1:44624662-44624684 AAGGACAGGGAGAAGGAGGGAGG + Intronic
906316025 1:44786847-44786869 GAGGCCAGGAGGAGGGAGGAGGG + Intronic
906610474 1:47198440-47198462 AAGGCCCTGAGGAAGGAGGCTGG + Intergenic
906647592 1:47486872-47486894 AAGGAAAAGAAAAAGCAGGAAGG - Intergenic
906708081 1:47909540-47909562 AAGGAGGAGAAGAAGGAAGAAGG + Intronic
906958606 1:50398923-50398945 AAAAGCAAGAAGAAGAAGGAAGG - Intergenic
907049802 1:51322222-51322244 GAGGCCTTGGAGAAGGAGGAGGG - Intronic
907190505 1:52644265-52644287 AAGGCAAAAAAAAAGGAGAAAGG + Intronic
907319899 1:53595599-53595621 AAGGCCACGGAGAGGGAGCAGGG - Intronic
907736798 1:57121199-57121221 AAGGAGAAGAAGGAGAAGGAGGG + Intronic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
907839820 1:58145932-58145954 GAGGCTGAGGAGAAGGAGGAGGG - Intronic
907920756 1:58909495-58909517 AAAGGGAAGAAGAAGGATGATGG + Intergenic
908003723 1:59707382-59707404 GAGGCCAAGCTGTAGGAGGAGGG + Intronic
908031836 1:60008865-60008887 AATGCCAAGCAGCTGGAGGAAGG - Intronic
908195855 1:61745060-61745082 AAGCCCAAGAAGATGGGGTAGGG - Intronic
908403488 1:63792039-63792061 AGGGCCAAGAAGAATGAGCAGGG + Intronic
908578320 1:65485833-65485855 ACATCCAAGAAGAATGAGGATGG + Intronic
908792703 1:67798582-67798604 TAGGCTGAGGAGAAGGAGGAAGG - Intronic
908833640 1:68206931-68206953 AAGGACAAGGAGGGGGAGGAGGG - Intronic
909491682 1:76233411-76233433 AAGCCCAAAAACAAGGAGTAGGG + Intronic
909774918 1:79471838-79471860 AAGGTCAAGATGAAGGGGCAAGG + Intergenic
909894270 1:81046847-81046869 AATGCAAAGAAGAAGCGGGAGGG + Intergenic
910252795 1:85215669-85215691 AGGGCCAAGTAGCAGAAGGATGG - Intergenic
910280956 1:85501289-85501311 AAGGCCAGGCGGTAGGAGGAGGG - Intronic
910386757 1:86692563-86692585 TAGGCCAGGAAGAAGGAAGAAGG + Intergenic
910593552 1:88953885-88953907 AAGAAGAAGAAGAAGAAGGAGGG - Intronic
910757977 1:90711157-90711179 GACCCCTAGAAGAAGGAGGAGGG + Intergenic
911008756 1:93255780-93255802 AAGAGGAAGAAGAAGGAGGGGGG + Intronic
911122740 1:94312327-94312349 AAAATGAAGAAGAAGGAGGAAGG - Intergenic
911741634 1:101392559-101392581 GAGGGCAAGAGGAAGGAGGGAGG - Intergenic
911778376 1:101843544-101843566 AGGGCCAACAAGAAGGATAAAGG + Intronic
911820311 1:102411259-102411281 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
913397802 1:118391719-118391741 AATGCCTAAAAGAAAGAGGATGG + Intergenic
913556276 1:119970408-119970430 AAGGCCAAGAATAATGAGACTGG + Intronic
913591874 1:120336814-120336836 AAGGTCCAGGAGAAAGAGGAAGG + Intergenic
913651482 1:120918332-120918354 AAGGTCCAGGAGAAAGAGGAAGG - Intergenic
913695796 1:121324269-121324291 AAGGACAAGAAGGAGAGGGAGGG - Intronic
913963694 1:143357590-143357612 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
914141770 1:144955788-144955810 AAGGACAAGAAGGAGAGGGAGGG + Intronic
914169627 1:145210738-145210760 AAGGTCCAGGAGAAAGAGGAAGG + Intergenic
914524740 1:148454700-148454722 AAGGTCCAGGAGAAAGAGGAAGG + Intergenic
914598934 1:149181133-149181155 AAGGTCCAGGAGAAAGAGGAAGG - Intergenic
914641660 1:149612435-149612457 AAGGTCCAGGAGAAAGAGGAAGG - Intergenic
914901198 1:151712054-151712076 CAGGCCACGAAGAAGGAGGCTGG - Intronic
914926395 1:151892251-151892273 AGGAGCAAGTAGAAGGAGGAGGG + Intronic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915271324 1:154755817-154755839 AAGAAGAAGAAGGAGGAGGAGGG + Intronic
915438256 1:155925764-155925786 AATGTCAAGGAGAAGGTGGAAGG - Exonic
915616409 1:157042951-157042973 GAGGCCAACAGAAAGGAGGAAGG + Intronic
915805880 1:158849196-158849218 AAGGCCAAGAAAAACAAGGAAGG + Exonic
915981882 1:160425466-160425488 AAGAGCAAGAAGAAGAAGGGTGG - Exonic
915984337 1:160448749-160448771 GAGGGCAAGGAGGAGGAGGAGGG - Intergenic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916384393 1:164251017-164251039 AGGGGCAAGAAGATGAAGGAAGG + Intergenic
916608271 1:166364125-166364147 GAGGCCAAAAAGAATGAGGAGGG - Intergenic
916616266 1:166444252-166444274 AAGGAGAAGAAGAAGAAGAAAGG + Intergenic
916651104 1:166835567-166835589 AAGCAGAAGAAGGAGGAGGAAGG - Intergenic
917410661 1:174757010-174757032 ATGGACAAGAAGCTGGAGGAAGG - Intronic
917505274 1:175621717-175621739 AAGGCAGAGAGGAAGGAGGGAGG - Intronic
917608723 1:176664368-176664390 CAGGCTTTGAAGAAGGAGGAAGG - Intronic
918002679 1:180512476-180512498 AAGGGCAAGAAGAAGGGGGCAGG + Intergenic
918023087 1:180714235-180714257 AAGGATGAGAAGGAGGAGGAAGG - Intronic
918540615 1:185627986-185628008 AAGGCTAAAAAGAGGGAGGCTGG - Intergenic
918730152 1:187983021-187983043 AAGGAGAACAAGAAGGATGAAGG + Intergenic
918833982 1:189435533-189435555 AAGGGGAAGGGGAAGGAGGAAGG + Intergenic
919016795 1:192048670-192048692 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
919094205 1:193010356-193010378 AAGGGGAAGAAGAAGAAAGAAGG + Intergenic
919196928 1:194298022-194298044 AAGGAGAAGAAGAGGGAAGAAGG + Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919766754 1:201132331-201132353 AAGGCCACGAGGAAGCAGGCTGG + Intergenic
919792976 1:201304210-201304232 GTGGCCAGGAAGGAGGAGGAGGG - Intronic
919913630 1:202127061-202127083 GAGGCAAAGAACAAGGGGGAAGG + Intronic
919917416 1:202147300-202147322 AAGGCCAAGCAGAAGCATTAGGG + Exonic
919988821 1:202694700-202694722 AAGGAAGAGGAGAAGGAGGAGGG - Intronic
920206977 1:204299350-204299372 GAGGACAGGAAGAAAGAGGAGGG + Intronic
920483121 1:206342637-206342659 AAGGACAAGAAGGAGAGGGAGGG - Intronic
920521254 1:206628700-206628722 AAGGAGAAGAAGAAGAAGAAAGG + Intergenic
920859434 1:209693373-209693395 AGGGCCAGGAAGAAGAAGGTGGG - Intronic
920866795 1:209759953-209759975 AATGCCAAGAGGGAGGAGAAGGG - Intronic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921382539 1:214539655-214539677 AAGGAAGGGAAGAAGGAGGAGGG + Intronic
921397055 1:214679620-214679642 AAGGAGAAGAAGAAGAAGAATGG - Intergenic
921586592 1:216953565-216953587 AGGGCCAAGAGGGAGGATGAAGG - Intronic
921787220 1:219245074-219245096 AAGAGAAAGAAGAAAGAGGAAGG - Intergenic
921945641 1:220884258-220884280 AAGGACAAGGACAAGGAGGCTGG + Exonic
922004659 1:221517615-221517637 AAGACAATGAACAAGGAGGAGGG + Intergenic
922061254 1:222094564-222094586 GAAGCCATGGAGAAGGAGGATGG - Intergenic
922167829 1:223130444-223130466 AGGGCCACGAAGAGGGAGGGAGG - Intronic
922249407 1:223834162-223834184 TAGGTCAAGAATAAGGAGTACGG + Intronic
922292883 1:224223388-224223410 AAGGCAAAGAAGATGAAGGAAGG - Intergenic
922484033 1:225959402-225959424 AAGGCCACTCAGAAGCAGGAAGG - Intergenic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
922936290 1:229425707-229425729 AAGGAGAAGAAAGAGGAGGAGGG + Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923072378 1:230577679-230577701 GAGGAGAAGAAGGAGGAGGAAGG - Intergenic
923072397 1:230577757-230577779 GAGGAGAAGAAGGAGGAGGAGGG - Intergenic
923072437 1:230577889-230577911 AAGGAGAAGAAGAAGGAGAAGGG - Intergenic
923436943 1:233976083-233976105 AAGGCGAAGGAGGAGGAGGGAGG + Intronic
923532369 1:234821635-234821657 ATGGCACAGAAGAATGAGGATGG + Intergenic
923534496 1:234838321-234838343 AGGGGAAAGAAGAAGGAAGAAGG + Intergenic
924005148 1:239600763-239600785 AAGGAAAAGAAGAAAAAGGAAGG - Intronic
1063096919 10:2916245-2916267 AAGACCAAGAACCAGGAGGCAGG + Intergenic
1063652077 10:7947695-7947717 AAGGCAGCTAAGAAGGAGGATGG + Intronic
1063671811 10:8105244-8105266 AAAGCCAAGAAGAGAGAAGACGG - Intergenic
1063874752 10:10462453-10462475 AAGGCAAAGAAGAAGCAGGGTGG - Intergenic
1063923110 10:10951143-10951165 AAAGAAAAGAAAAAGGAGGATGG - Intergenic
1063938942 10:11107803-11107825 AGGGGGAAGAAGAGGGAGGAGGG - Intronic
1064003528 10:11682675-11682697 AAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1064165131 10:12979342-12979364 AAGGGAAAGAACAAGCAGGAGGG - Intronic
1064393064 10:14958138-14958160 AAAGACATGAAGAAGGAGCAGGG + Intergenic
1064494232 10:15890976-15890998 GAGACAAAGAAAAAGGAGGAAGG + Intergenic
1065279275 10:24117984-24118006 AAAGCCAAGAAAGGGGAGGAGGG + Intronic
1065318506 10:24487115-24487137 AGGGAGAAGAAGAAGGAGAAGGG - Intronic
1065377463 10:25058155-25058177 GAGGACAAGTAGAGGGAGGAAGG - Intronic
1065494991 10:26318589-26318611 AAGGCAGGGAGGAAGGAGGAAGG + Intergenic
1065742027 10:28805672-28805694 CAGGGCAAGAAAAAGGAGTAGGG - Intergenic
1065825048 10:29562990-29563012 AAGGGCAAGAAGGAGTAGAAAGG + Intronic
1065830959 10:29613184-29613206 AAAAAAAAGAAGAAGGAGGAGGG + Intronic
1065915931 10:30355033-30355055 AAGGTCCTGAAGTAGGAGGAAGG + Intronic
1065952361 10:30663829-30663851 AAGGGCAAGAAGGAGCAGAAAGG - Intergenic
1066084841 10:31966051-31966073 ATGGCAAGGAAGAAGAAGGATGG + Intergenic
1066169710 10:32828413-32828435 AAGGAGAAGAAGAAGAAGGAAGG + Intronic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
1066447415 10:35496374-35496396 AAGGCCCAGAAGAAGAAGAGAGG - Intronic
1067083823 10:43227921-43227943 ATGGCAGAGAAGGAGGAGGAGGG - Intronic
1067128149 10:43537792-43537814 AAAGAAAAGAAGAAGAAGGAAGG - Intergenic
1067239740 10:44480455-44480477 AAGGGCAAGCCGAAGCAGGAGGG + Intergenic
1067468333 10:46517854-46517876 AAGACCAAGAAGAGGAAGGTGGG + Intergenic
1067565514 10:47333466-47333488 AGGTCCAGGAAGAAAGAGGAAGG - Intergenic
1067787123 10:49258565-49258587 GGGGCCAGGAAGAAAGAGGAGGG + Intergenic
1067920361 10:50449559-50449581 AAGGACATGAAGAAAGTGGAGGG - Intronic
1068150593 10:53125767-53125789 AAGGACAAGATGAAGGTGAATGG + Intergenic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1068262610 10:54601972-54601994 GAGGCCAACCAGAAGGTGGAGGG + Intronic
1068341813 10:55714109-55714131 AAGGCCAGGAAGAATATGGAGGG - Intergenic
1068688662 10:59894300-59894322 AATGCCGAGAAAAATGAGGATGG - Intronic
1068777863 10:60887615-60887637 AGGGCCAAGGAGCATGAGGACGG + Intronic
1069178762 10:65329030-65329052 AAGGCCAAGAAGATGGTGTTTGG + Intergenic
1069335146 10:67340174-67340196 AAGGGCAGGAGGAAGGAGGAGGG + Intronic
1069588872 10:69630023-69630045 AAGAAGGAGAAGAAGGAGGAGGG - Intergenic
1069667762 10:70175049-70175071 AAGCCCAAGAAAAAGGCTGAAGG - Intergenic
1069718510 10:70535551-70535573 AAGGAAGAGAAGGAGGAGGAAGG - Intronic
1069854937 10:71434908-71434930 CATGCCAAGAAGAAGGCAGATGG - Intronic
1069963159 10:72090656-72090678 GAGGCCAAGAGGCAGGAGGATGG + Intergenic
1069979105 10:72239908-72239930 AAGGGCAAGAATAAGGCAGAGGG + Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070441162 10:76444757-76444779 TAGGCCAGGAAGAAGGACAATGG + Intronic
1070444615 10:76484153-76484175 GAGAGGAAGAAGAAGGAGGATGG - Intronic
1071024559 10:81097465-81097487 GAGGGAAAGAATAAGGAGGAAGG - Intergenic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071268973 10:83989794-83989816 AAGGGAGGGAAGAAGGAGGAAGG + Intergenic
1071268981 10:83989835-83989857 AAGGGAGGGAAGAAGGAGGAAGG + Intergenic
1071991685 10:91105754-91105776 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1072802141 10:98399703-98399725 AAAGCCAAAAAGGAGGATGAGGG - Intronic
1072997528 10:100258785-100258807 AAGGCCAAGATGAACTATGATGG + Intronic
1073260823 10:102188882-102188904 AAGGCCAAGCAGCAAGAGCAGGG + Intergenic
1073290873 10:102412647-102412669 CAGGCCCAGAAGATGGAGAAGGG + Intronic
1073451692 10:103613395-103613417 CAGGCAAAGAAAAAGGAGCATGG - Intronic
1073470962 10:103721795-103721817 AAGGCAAGGATGAAGAAGGAAGG + Intronic
1073479917 10:103779931-103779953 GAGGCCCTGAAGAAGGGGGAAGG + Intronic
1073498289 10:103913899-103913921 CAGGCCCCCAAGAAGGAGGAGGG + Intronic
1073559243 10:104482803-104482825 AAGGTCAAGAAGGAGGAGCAAGG - Intergenic
1073764313 10:106665350-106665372 AAGGGAAGGAAGAAGGAGAAAGG - Intronic
1074101709 10:110359041-110359063 AAGGCAGAGAAGGAGCAGGAGGG + Intergenic
1074112276 10:110431089-110431111 CAGGCCCAGAAGGAGGAGCAGGG - Intergenic
1074278134 10:112024200-112024222 GTGGCCAAGAAGATGGAGGAAGG - Intergenic
1074657573 10:115611917-115611939 AAGGCCAAAAATTATGAGGAAGG + Intronic
1074732174 10:116390825-116390847 AAGGAGAAGAAGAAGAAGGAAGG + Intergenic
1075316142 10:121455167-121455189 AAGGCCACCAGGAAGGAGAAGGG - Intergenic
1075556547 10:123436421-123436443 AAAGACAAGTAGAAAGAGGAGGG - Intergenic
1075591503 10:123694687-123694709 AAGGAAAAGAAAAAGAAGGAAGG + Intergenic
1075800293 10:125149539-125149561 AAGGCCAAGATGGAGGCGGGGGG + Intronic
1076167123 10:128291821-128291843 AAGCCACTGAAGAAGGAGGACGG - Intergenic
1076272409 10:129165934-129165956 AAAGAAGAGAAGAAGGAGGAAGG + Intergenic
1076348002 10:129793854-129793876 AAGGAAAAGAGGAAGGAAGAGGG - Intergenic
1076475300 10:130747599-130747621 AAGGCTAGGAAGAAACAGGAAGG - Intergenic
1076568591 10:131415921-131415943 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1076870882 10:133193569-133193591 AAGAACAAGAAGAAGGAAAAAGG + Intronic
1077159988 11:1108307-1108329 AAGGGCAGGCTGAAGGAGGAGGG - Intergenic
1077651353 11:3975624-3975646 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1077871475 11:6265867-6265889 GAGGCAAAGAAGAAGAAGAAAGG + Intronic
1078127696 11:8584635-8584657 AGGGCCAGGCATAAGGAGGAAGG - Intronic
1078155593 11:8797447-8797469 AAGGGGAAGAAGGAGGAAGAAGG - Intronic
1078478427 11:11655008-11655030 GAGGACCACAAGAAGGAGGAGGG + Intergenic
1078659662 11:13277266-13277288 GGGGAGAAGAAGAAGGAGGAGGG + Intronic
1078697015 11:13644546-13644568 AAGGCAAAAAGGAAGGAGGCAGG + Intergenic
1078733041 11:13993257-13993279 AAGGCCGAGGAGAAGGGGGTGGG + Intronic
1079132560 11:17756030-17756052 AAGTGCAAGAAGAAGGAGGGAGG + Intronic
1080290546 11:30666053-30666075 TAGAACAAGAAGAAGGAGAAGGG + Intergenic
1080295297 11:30720326-30720348 AAGAGAAAGAAGAAGGAAGAAGG - Intergenic
1080791184 11:35524109-35524131 AAGGCGAAGATGAAGTAGGGAGG + Intronic
1080960805 11:37157640-37157662 AAGGACAAGATGAGGGAAGAAGG - Intergenic
1081004883 11:37723962-37723984 AAGGTCAAGAAGAAAGATGTAGG - Intergenic
1081548722 11:44092762-44092784 TAGGCCAAGGAGGAGAAGGAAGG + Intergenic
1081659487 11:44879267-44879289 TAGGGAAAGAAGAAGGAGGAAGG - Intronic
1081709236 11:45206298-45206320 GAGGCCCAGATGAAAGAGGAGGG + Intronic
1082721820 11:56687139-56687161 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1082733698 11:56831760-56831782 AAATACAAGAAGGAGGAGGAAGG + Intergenic
1082892401 11:58154095-58154117 AAGGGGAGGAGGAAGGAGGAGGG + Intronic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1082892430 11:58154195-58154217 AAGGGGGAGGAGAAGGAGGAAGG + Intronic
1083001800 11:59299046-59299068 AAGAACAAGAAGAAGAAAGAAGG + Intergenic
1083295308 11:61712161-61712183 CTGGCCAAGAAGCACGAGGAGGG + Intronic
1083598777 11:63933429-63933451 AAGGCCAACAAGTAGCAGAAAGG + Intergenic
1083629083 11:64086560-64086582 AAGGCCCGGAGGCAGGAGGAAGG - Intronic
1083830875 11:65232826-65232848 AAAGAGAAGAAGATGGAGGAAGG - Intergenic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084575799 11:69987144-69987166 AAGGCCCAGAAGAAAGAGAAAGG + Intergenic
1084685379 11:70691320-70691342 AAGGCAAGGGAGAATGAGGAGGG + Intronic
1084769602 11:71334226-71334248 TAGGCCCAGGAGAAGGAGGGAGG + Intergenic
1084791478 11:71477780-71477802 GAGGCCAACACAAAGGAGGATGG - Intronic
1085011011 11:73141920-73141942 AAGGACCAGGAGGAGGAGGAGGG + Exonic
1085012779 11:73152873-73152895 AAGGCCTAGCAGAAGGAAGTGGG + Intergenic
1085033038 11:73284116-73284138 AAGGCTTAGAAGACAGAGGAGGG + Intronic
1085084167 11:73655765-73655787 AAACCCAAGAAGGAGGAGGGAGG - Intronic
1085150247 11:74246672-74246694 AAGGCATAGATGAATGAGGAAGG - Intronic
1085179415 11:74521020-74521042 ATGGCCAAGAGGCAGGATGAGGG + Intronic
1085258063 11:75188169-75188191 GAGTCCACGAAGAAGCAGGATGG + Exonic
1085308026 11:75499374-75499396 AAGGAAAAGAAGAAGAAAGAAGG - Intronic
1085612512 11:77964714-77964736 AAGGGCAAGTGGAGGGAGGAAGG + Intronic
1085657179 11:78326957-78326979 AAGGCTAAGAAGAAATTGGATGG + Intronic
1085895854 11:80638692-80638714 AAGGCAAAGGAGAAGAAGAAGGG + Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086129117 11:83382836-83382858 GAGGGCAAGAAGAAGCAGGGTGG + Intergenic
1086259616 11:84923432-84923454 AAGAAGAAGAAGAAGGAGGGGGG + Intronic
1086948537 11:92867784-92867806 AAAGTCAAGAATAAGGAGAAGGG + Intronic
1087583989 11:100094734-100094756 CAGGGAAAGAAGAAGGAGGGAGG + Intronic
1087726678 11:101725989-101726011 AAGGAAGAGAATAAGGAGGAAGG + Intronic
1087995233 11:104797969-104797991 AAGGCCACGATAAAGGAGTATGG + Intergenic
1088047610 11:105472782-105472804 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1088197678 11:107293867-107293889 GAGGGCAAGAGGAAGGAGGGCGG + Intergenic
1088751882 11:112849191-112849213 AAGGACAAGAGGAAGGAAGAAGG - Intergenic
1088796527 11:113270358-113270380 AAGGGCAAGGACATGGAGGAGGG + Exonic
1089109605 11:116044826-116044848 AAAACCAAGAAGGAGAAGGAGGG - Intergenic
1089295441 11:117464610-117464632 CGTGCCAGGAAGAAGGAGGAAGG + Intronic
1089553494 11:119300406-119300428 AACACCAAGAAGGATGAGGAAGG - Exonic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090720237 11:129466132-129466154 GAGGCCATGAAGAAGGCAGAGGG + Intergenic
1090892710 11:130940398-130940420 AAGGAGAAGAACAAGGTGGAAGG + Intergenic
1091406837 12:214433-214455 AAGGGCAAGGAGGAGGAGGAGGG - Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1091899729 12:4135071-4135093 AAGGCCGAGAGGATGCAGGAAGG - Intergenic
1092092267 12:5812699-5812721 AAAGAAAAGAAGAAGAAGGAAGG + Intronic
1092201263 12:6585245-6585267 AAGACCAAGAAAAAGAAGGGAGG + Intronic
1092527741 12:9319496-9319518 AAGTTGAAGAGGAAGGAGGACGG - Intergenic
1092576017 12:9783213-9783235 AAAGGCAAGAAGAAGGTGGTGGG + Intergenic
1092722637 12:11456993-11457015 AAGGCAAAGAAGAAGGTAAAGGG + Intronic
1092727728 12:11500910-11500932 AAGGCCAACAAGGAGAAGAAAGG + Intronic
1092778158 12:11961986-11962008 AGGGCCAGGAAGCAGGAGGTGGG + Intergenic
1093925221 12:24902826-24902848 GAGGGCAAGGCGAAGGAGGATGG + Intronic
1094171261 12:27494813-27494835 AAGGCCAAAGGGAAGGAGGAAGG - Intronic
1094303431 12:28991791-28991813 AAGGCCCAGCAGAAACAGGAGGG - Intergenic
1094355492 12:29573501-29573523 AGGGTGAAGAAGTAGGAGGAGGG + Intronic
1094499988 12:31012543-31012565 AAGTTGAAGAGGAAGGAGGACGG - Intergenic
1094766967 12:33607997-33608019 AAGGACAAGAAGAAGGATATGGG - Intergenic
1095298840 12:40558766-40558788 AAGGCAAAGAAGAATGAGGTAGG - Intronic
1095404187 12:41849511-41849533 TAGGCAAAGAAGAAGGAGGTGGG - Intergenic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096255346 12:50058776-50058798 AAGGCCGAGGAGGAGGAGGTGGG + Exonic
1096510089 12:52122893-52122915 AAAGACATGTAGAAGGAGGAAGG - Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096828873 12:54299554-54299576 CAGGCTAAGAGTAAGGAGGATGG - Intronic
1096921250 12:55088044-55088066 AAGCTGGAGAAGAAGGAGGATGG + Intergenic
1097091390 12:56508153-56508175 GAGGAGAAGAAGAAGGAAGAAGG - Intergenic
1097163349 12:57066602-57066624 AGGCCCAAGAAGAAGGGAGACGG + Intronic
1097237886 12:57552130-57552152 AAGGCTGAGAAACAGGAGGAGGG + Intronic
1097507008 12:60486022-60486044 AAGGACCAGAACAAGGGGGAAGG + Intergenic
1097825645 12:64172448-64172470 AAGGAAAAGAGGAGGGAGGAGGG + Intergenic
1097983307 12:65756316-65756338 AGGGAAGAGAAGAAGGAGGAAGG - Intergenic
1098017713 12:66123911-66123933 AAGGCAAAGAAAAAGGCTGAAGG - Exonic
1098290254 12:68951417-68951439 AAGGAAAAGAAGGAGTAGGATGG + Intronic
1098306398 12:69107017-69107039 CATGGCAAGAAGAAGCAGGAAGG - Intergenic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1099051401 12:77785465-77785487 AAGGTGAAGAAGTAGGAGGAGGG + Intergenic
1099064943 12:77964020-77964042 AAGGAGAAAAAGGAGGAGGAGGG - Intronic
1099163857 12:79277014-79277036 AAGAGGAAGAAGAAGGAGAAGGG + Intronic
1099239015 12:80116345-80116367 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1099398439 12:82170982-82171004 AAGAAAAAGAAGGAGGAGGAGGG + Intergenic
1099616430 12:84941516-84941538 AAGGAAAAGGAGAAGGAGAAGGG + Intergenic
1100211450 12:92402583-92402605 AAGAACATGAAGAAGAAGGAGGG - Intergenic
1100461148 12:94800532-94800554 AAGGCCAAGAAGAAGAAAGCTGG + Intergenic
1100550731 12:95644353-95644375 AAGGAGAAGAAGAAGGGGCAAGG - Intergenic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1100550742 12:95644399-95644421 AAGGGGGAGAAGAAGGGGGAAGG - Intergenic
1101025141 12:100595937-100595959 AAAGAAGAGAAGAAGGAGGAGGG - Intronic
1101446861 12:104742800-104742822 GAGGCCAAGAAACAAGAGGAGGG - Intronic
1101450455 12:104772820-104772842 AAGGGCAAAAAGAAGGGGAATGG - Intergenic
1101808875 12:108090781-108090803 AAGGGCAAGAAGAAGGCAGTGGG + Intergenic
1101890487 12:108710299-108710321 AAGGCCAAAAAGGAGGATTACGG + Intronic
1102544100 12:113642312-113642334 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1102709878 12:114916547-114916569 GAGGGGAAGAAGAAGGAGGAAGG - Intergenic
1102733541 12:115136712-115136734 AAGATGAAGAAGAAGGAGCAAGG + Intergenic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1103005632 12:117418096-117418118 AAGGTAGAGAGGAAGGAGGAAGG + Intronic
1103195785 12:119042674-119042696 AAGGGCAGGAAGAGGGAGGAAGG + Intronic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103367028 12:120390820-120390842 AAGGAAAGGAAGAGGGAGGAAGG + Intergenic
1103862931 12:124028595-124028617 AGGGCCAAGCAAAAGCAGGAGGG + Intronic
1103915099 12:124372133-124372155 AAGGCAGAGAAGAAGGAGGGCGG - Exonic
1103956796 12:124581960-124581982 AAGGGAAAGTAGAAGGAGGTAGG + Intergenic
1104373212 12:128242662-128242684 AGGCCCATGAAGGAGGAGGATGG + Intergenic
1104981009 12:132573123-132573145 AAGGCCAGGAACAGTGAGGAGGG - Intronic
1105205368 13:18218831-18218853 AAGGCAAAGAAACAGGAGCAAGG - Intergenic
1105966340 13:25388181-25388203 AAGGAGAGAAAGAAGGAGGAAGG + Intronic
1106042063 13:26103094-26103116 GAGGGCAAGCAGAAGCAGGATGG + Intergenic
1106122097 13:26868836-26868858 TAGGTCAAGAAGGAAGAGGATGG - Intergenic
1106497867 13:30297163-30297185 AAAGAAAAGAAGGAGGAGGAAGG + Intronic
1106885564 13:34181203-34181225 AAGGAAAAGAAGAAAGAGAAAGG - Intergenic
1106942601 13:34794588-34794610 ATAGCCAAGAAGCAGGATGAGGG - Intergenic
1107433708 13:40362976-40362998 AACGCCGAGGAGGAGGAGGAGGG - Intergenic
1107795466 13:44046933-44046955 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1108274018 13:48789764-48789786 GAGGGCAGGAAGAAGGAGGAAGG + Intergenic
1108679922 13:52771209-52771231 GAGGACTACAAGAAGGAGGAGGG - Intergenic
1108723693 13:53158793-53158815 AAAGGAAAGAAGAAGAAGGAAGG - Intergenic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1108937528 13:55902199-55902221 GAGACCCAGAAGGAGGAGGATGG + Intergenic
1109086445 13:57977875-57977897 AAGGCTAAGAAAATGGAGGATGG + Intergenic
1109233958 13:59792832-59792854 AATGCCAAGAAGATGGAGTTTGG - Intronic
1109260156 13:60136072-60136094 ATTGCCAAGAAGAGGGAGAAAGG + Intronic
1109384705 13:61611163-61611185 AAGGAAAAGAGGAAGGAGGCAGG - Intergenic
1109877180 13:68420684-68420706 AACCCCAAAAGGAAGGAGGAAGG - Intergenic
1110747239 13:79068587-79068609 AGGGCCAAGAAGGGGGAGTAAGG + Intergenic
1110940576 13:81343576-81343598 AAAGCTAAGAAGAAAGATGAGGG + Intergenic
1111444603 13:88330827-88330849 GAGGGAAAGAAGAAGGAGAAGGG - Intergenic
1111681967 13:91453788-91453810 AAAGAAAGGAAGAAGGAGGAGGG - Intronic
1111954497 13:94741801-94741823 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1112124285 13:96447558-96447580 AAGGGCAAGAAGAAGGCAGCAGG - Intronic
1112237718 13:97651187-97651209 AAGGGCAAGAAGAAGAGGGCAGG + Intergenic
1112630895 13:101160299-101160321 AAAGCGAAAAAGAAGGAAGAGGG - Intronic
1112643170 13:101300299-101300321 AAGAGGAAGAAGAAGAAGGAGGG - Intronic
1113088419 13:106592236-106592258 TAGGCCAAGGAGGAGGAGGAGGG - Intergenic
1113093412 13:106638019-106638041 AAGACCAAGAAAAAAGAGAATGG - Intergenic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113266065 13:108619643-108619665 CTGGCCAAGAAGAAAGGGGAAGG + Intronic
1113613296 13:111663323-111663345 AAGGTGAGGAAGAAGGAGGAGGG - Intronic
1113613312 13:111663395-111663417 AAGGCGAGGAAGAAGGACGAGGG - Intronic
1113650108 13:112028499-112028521 ATGGCCCAGAGGAAGGAGGGAGG + Intergenic
1113670028 13:112170343-112170365 GAGGCCGAGAAGATGGAGGTGGG + Intergenic
1113754784 13:112803828-112803850 AAGGAGAGGAAGGAGGAGGAGGG - Intronic
1114637135 14:24194208-24194230 AAGGCCTAGAAAAAGGAGAGCGG + Intronic
1114744901 14:25136567-25136589 AAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115318008 14:32046564-32046586 AAAGGCCAGAAGAAGGAAGAAGG - Intergenic
1115421474 14:33199706-33199728 GAGGGGAAGAAGAAGGGGGAGGG - Intronic
1115620118 14:35132837-35132859 AAGGGAAGGAAGAAGGAAGAAGG + Intronic
1115688505 14:35821277-35821299 AAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116307518 14:43277360-43277382 AAGACCAAGAAGAATAAGGCAGG + Intergenic
1116357391 14:43946340-43946362 AATGCCAAAAAGAGGGAAGAAGG - Intergenic
1116868367 14:50049514-50049536 GAGGCCAGGAAGAGGGAGGCTGG - Intergenic
1117031829 14:51679953-51679975 ATGCCAAAGAAGAAGGGGGAAGG + Intronic
1117237741 14:53796662-53796684 ATGGCAAAGAAAATGGAGGACGG - Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117506725 14:56411757-56411779 AAGGAGAAGAAGAAGAAGAACGG + Intergenic
1118004624 14:61554292-61554314 AGAGCCAGGAAGCAGGAGGAGGG - Intronic
1118077783 14:62319887-62319909 AAGCTCAAGAAGCAGAAGGATGG - Intergenic
1118439803 14:65802022-65802044 AAAGCCAAGAAGAGGGACAAAGG - Intergenic
1118533909 14:66737229-66737251 AAGGGGAAAAAGAAAGAGGAAGG - Intronic
1118900398 14:69981063-69981085 AAGGCAGAGCAGAAGGAGGCTGG + Intronic
1118978679 14:70699026-70699048 ACAGCCAAGAACAGGGAGGAAGG + Intergenic
1119147200 14:72328129-72328151 TAGAACAAAAAGAAGGAGGAGGG - Intronic
1119714004 14:76845344-76845366 AAGGAAAAGAAGAAGGGGAAGGG + Intronic
1119964809 14:78902532-78902554 AAGGAGATGAAGGAGGAGGAAGG + Intronic
1119997651 14:79271382-79271404 AGGGGAAGGAAGAAGGAGGAAGG - Intronic
1120046675 14:79815565-79815587 AAGGCGAAGAAAGAGGAGGAGGG + Intronic
1120366737 14:83580956-83580978 AAGGGCTAGAAAAATGAGGAAGG - Intergenic
1120388129 14:83871237-83871259 AAGGGGGAGAAGAAGGAGGAAGG + Intergenic
1120613232 14:86668603-86668625 AAGGAAAAGAAAAAGGAAGAGGG - Intergenic
1120880811 14:89413979-89414001 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1121074977 14:91060421-91060443 AAGGAGAAGATGGAGGAGGAGGG - Exonic
1121173579 14:91873940-91873962 TAGGGCCAGAAGAAGGAGCAAGG - Intronic
1121665684 14:95670525-95670547 AACTCCAAGAAGGAGAAGGAAGG - Intergenic
1121757427 14:96414712-96414734 CAGGCCAAGAAGACGGATGGAGG + Intronic
1121764067 14:96470247-96470269 AAGGCGGAGAAGGATGAGGAGGG + Intronic
1122091794 14:99345803-99345825 AACCCCATGCAGAAGGAGGAGGG + Intergenic
1122126596 14:99581730-99581752 AAGGCCACGAAGCAGGATGGGGG + Intronic
1122635571 14:103128117-103128139 CAGGCCAGGAGGCAGGAGGAGGG + Intronic
1123726701 15:23110233-23110255 AAGGCTCAGAAGGAGGAGCAGGG + Intergenic
1124113964 15:26822102-26822124 AAGGCTAAGAAGAAGGAACGAGG + Intronic
1124160916 15:27269058-27269080 CTGGCCAAGATGAAGGAAGAAGG - Intronic
1124185650 15:27526157-27526179 AAGGCCCAGAGCAAGGTGGAGGG + Intronic
1124534071 15:30529389-30529411 AAGGCTAAAAAGAAGGAAGAGGG - Intergenic
1124764576 15:32478221-32478243 AAGGCTAAAAAGAAGGAAGAGGG + Intergenic
1124841108 15:33243048-33243070 TAGGCCTGGAGGAAGGAGGATGG - Intergenic
1125065894 15:35486134-35486156 AAGGCAAAGGAGAAGCAGGCAGG + Intronic
1125076924 15:35630315-35630337 AAGTAAAAAAAGAAGGAGGATGG + Intergenic
1125089764 15:35776608-35776630 AAGGCCCAAAAGAAGGAGAATGG + Intergenic
1125891958 15:43273705-43273727 AAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1125987348 15:44067022-44067044 AAGTCCAAGAAGAAGAGGGATGG + Intronic
1126037587 15:44561024-44561046 AAAGCCAAAAAGAAGAAGAAAGG + Exonic
1126076094 15:44911250-44911272 AAGGAAAAGAAGAGAGAGGAAGG + Intergenic
1126251568 15:46573579-46573601 GAAGCCCAGAAGAAGGAGAAAGG + Intergenic
1127122105 15:55780596-55780618 AGGGAGAAGAAGAAGGAAGAAGG + Intergenic
1127122372 15:55782802-55782824 AAGGCCAAGGAGAATAAAGATGG + Intergenic
1127296232 15:57610972-57610994 AAGACCAAGAAGAAGGTGGACGG + Intronic
1127318042 15:57815989-57816011 GAGGCCCATAAGAAAGAGGATGG + Intergenic
1127585873 15:60377253-60377275 AATATCAAGGAGAAGGAGGAAGG + Intronic
1127966799 15:63928779-63928801 CAGGCAAAGAGGAAGGAGAAAGG + Intronic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128339225 15:66808762-66808784 AAGAACAAGAAGCTGGAGGAAGG + Intergenic
1128358297 15:66943546-66943568 AAGGGAAAGAAGAGGGAGGGAGG - Intergenic
1128484258 15:68069340-68069362 ACGGGCAAAAGGAAGGAGGAGGG - Intronic
1128716772 15:69914315-69914337 AAGGCCAGGAGGTAAGAGGAGGG - Intergenic
1129044877 15:72725761-72725783 AAGGGGAAGAGGAAGGGGGAAGG - Intronic
1129104299 15:73295440-73295462 AAACCCAGGAGGAAGGAGGAAGG - Intronic
1129240978 15:74252121-74252143 AAGGCAAAGAATGAGGTGGAGGG - Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129801448 15:78418100-78418122 AAGGCCAAGAGGCTGGGGGAGGG + Intergenic
1130024508 15:80259951-80259973 GAGCCCAAGAAGAAGGAAGAAGG - Intergenic
1130064471 15:80592722-80592744 AAGGCCTTACAGAAGGAGGAAGG - Intronic
1130090528 15:80817086-80817108 AAAGCCATGGTGAAGGAGGAAGG + Intronic
1130112725 15:80979283-80979305 AAGGGCAAAAAAAAGAAGGAAGG - Exonic
1130128714 15:81117841-81117863 AAGGACTAGGAGAATGAGGATGG - Intronic
1130229075 15:82082618-82082640 AGGGCCCAGAAGAAGGAGCCAGG - Intergenic
1130795137 15:87199860-87199882 AAGAAAAAGAAGAAAGAGGAAGG + Intergenic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1131014142 15:89043472-89043494 AAGGAGAGGAAGAAGGGGGAGGG + Intergenic
1131284840 15:91048191-91048213 AAGAAGAAGAAGAAGAAGGAGGG - Intergenic
1131319790 15:91376351-91376373 AATGTGAAGAAGTAGGAGGAAGG + Intergenic
1131430162 15:92380888-92380910 AAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1131676368 15:94674520-94674542 AAGTCAAAGAAGAAGGAGAGGGG - Intergenic
1131872162 15:96774449-96774471 AAAGCCAAGAAACAGGAAGATGG + Intergenic
1132014204 15:98301493-98301515 AAGACAAAGAAGAAAAAGGAGGG + Intergenic
1132100197 15:99017557-99017579 AAGGCCAAGGTAAAGGATGAGGG - Intergenic
1132185338 15:99798349-99798371 AAGGGGAGGAAGAAGGAGGGAGG + Intergenic
1132200166 15:99947465-99947487 AAGAGCATGAAGATGGAGGAGGG - Intergenic
1132431651 15:101766182-101766204 AAGGAGAGGAAGAAGGAGGGAGG - Intergenic
1132580046 16:680529-680551 AAGGGCAAGGAGGAGAAGGAGGG + Exonic
1132779041 16:1612905-1612927 AGGGCCAACAAGCAGGGGGATGG - Intronic
1132799929 16:1747004-1747026 AAGGCCAAACACAGGGAGGAGGG - Intronic
1132838012 16:1964444-1964466 AAGGCCGAGGATAAGGAGGTAGG - Exonic
1132885353 16:2179889-2179911 AAGGCCAAGGAGCGGGAGGCCGG - Exonic
1133000532 16:2849160-2849182 CAGGACTAGAAGAAGGAGGAAGG + Intergenic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1134197544 16:12170524-12170546 AAGCTCAGGCAGAAGGAGGAGGG + Intronic
1134287185 16:12872041-12872063 AAGAGGAAGAAGAAGGAGGAGGG - Intergenic
1134385028 16:13763829-13763851 AAGCCTAGGACGAAGGAGGAAGG - Intergenic
1134657302 16:15956797-15956819 GAGGCTAAGGAGGAGGAGGAAGG + Intronic
1134770605 16:16806050-16806072 AAGGGGAAGGAGAAGGGGGAAGG - Intergenic
1135155600 16:20050297-20050319 AAGGCCAAGAAGCAAGAGACGGG + Intronic
1135170434 16:20178908-20178930 AAAGACAAGAAGAAGGAGGAGGG - Intergenic
1135728185 16:24873192-24873214 AAGGGAAAGGAGAAGAAGGAAGG + Intronic
1135795971 16:25442858-25442880 AAGGGAAAGGAGAAGGAGAAGGG - Intergenic
1135913147 16:26579214-26579236 AAGGAGGAGAAGAAGAAGGAAGG - Intergenic
1135939591 16:26809742-26809764 AATGCAAGGGAGAAGGAGGAAGG + Intergenic
1136408161 16:30061275-30061297 TAGGCAAAGAAGAAAGAAGAGGG - Intronic
1136452170 16:30359609-30359631 AAGAGCAAGAACAAGGAGGAGGG + Intronic
1136539095 16:30918701-30918723 AAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1136689939 16:32021881-32021903 AAATCCAAGAAGAGTGAGGAGGG - Intergenic
1136776200 16:32873108-32873130 ATGGACAAGAAGAAAGAGTAAGG + Intergenic
1136790524 16:32965442-32965464 AAATCCAAGAAGAGTGAGGAGGG - Intergenic
1136879290 16:33888490-33888512 AAATCCAAGAAGAGTGAGGAGGG + Intergenic
1136894415 16:33988404-33988426 ATGGACAAGAAGAAAGAGTAAGG - Intergenic
1137386497 16:48047474-48047496 AAGGAGGAGAAGCAGGAGGAGGG + Intergenic
1137758794 16:50923963-50923985 AAGGAGAAAAAGAGGGAGGATGG + Intergenic
1137811673 16:51358622-51358644 AGGGCCAAGAAAGAGGATGAAGG + Intergenic
1138201789 16:55094118-55094140 AGGTCCAAGAAGAAGAAGCATGG - Intergenic
1138243486 16:55447720-55447742 ATGGCCAAGCAGAAGGACCAAGG + Intronic
1138289596 16:55835595-55835617 AAGGAGAAGAAGGAGAAGGAGGG + Intergenic
1138420072 16:56893114-56893136 CAGGCCAGGAAGGAGAAGGAAGG - Intronic
1138554387 16:57763331-57763353 CAGGCCAGGCAGGAGGAGGAAGG - Intronic
1138621174 16:58212568-58212590 AAAGGAAAGAATAAGGAGGAAGG + Intergenic
1138901964 16:61283090-61283112 AAAACAAAGAAAAAGGAGGAGGG - Intergenic
1139018128 16:62714847-62714869 AAGGAGAAAAAGAAGGAGAAGGG - Intergenic
1139150090 16:64371489-64371511 AAGGTCACGTAGAAGGAGGGAGG + Intergenic
1139267606 16:65654923-65654945 AAGGACCAGAAGAGAGAGGAGGG + Intergenic
1139381995 16:66538377-66538399 AAGACCTAGAAGAAGGAGAGGGG - Intronic
1139605162 16:68013062-68013084 AAGGAGAAGAAGAAGAAAGAAGG + Intronic
1139760354 16:69180086-69180108 AGGGAAAAGAAGAAAGAGGAAGG - Intronic
1139800936 16:69522161-69522183 TAGGTGAAGAAGAGGGAGGAGGG + Intergenic
1139897739 16:70301111-70301133 AAAGACAAGAGAAAGGAGGAAGG - Intronic
1140375380 16:74441344-74441366 ACTGTCAAGAAGAAGGAGGAAGG - Intergenic
1140701154 16:77582676-77582698 AAGCCCAAAAGGAAGGAGAATGG - Intergenic
1140962590 16:79930901-79930923 AAGGCCAAGTGGATGGATGATGG - Intergenic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141171769 16:81696181-81696203 AAGGCATAGCAGAAGGAGAAAGG + Intronic
1141294134 16:82751037-82751059 AAGATCAGGAAGGAGGAGGATGG - Intronic
1141500925 16:84443534-84443556 AAGTCCAGGAGGAAGCAGGAAGG - Intronic
1141775773 16:86121797-86121819 AGGGACAAGCAGGAGGAGGAAGG - Intergenic
1141775829 16:86121976-86121998 AGGGACAAGGAGAAGGAGGAGGG - Intergenic
1141845220 16:86603891-86603913 AAGGAAAGGAAGGAGGAGGAGGG - Intergenic
1142018574 16:87765859-87765881 AAGGGCAAGAAGGAGAAGAAGGG - Exonic
1142050483 16:87954891-87954913 AAGGCCACAAGGAAGCAGGAAGG - Intronic
1142155814 16:88532463-88532485 AAGGCGGAGGAGGAGGAGGAGGG + Intronic
1142305523 16:89282412-89282434 AAGGCCGAGAAGAAAGAGAAGGG - Exonic
1142431541 16:90031202-90031224 AAGGCAAGGAAGAAAGAGGGAGG - Intronic
1203078615 16_KI270728v1_random:1135217-1135239 ATGGACAAGAAGAAAGAGTAAGG + Intergenic
1203092727 16_KI270728v1_random:1226900-1226922 AAATCCAAGAAGAGTGAGGAGGG - Intergenic
1143018498 17:3904329-3904351 AAGGCCAAGAGGAAGGCCCAAGG - Exonic
1143085496 17:4413079-4413101 CAGGGCAGGAGGAAGGAGGACGG - Intergenic
1143287325 17:5800063-5800085 AAGGTGGAGGAGAAGGAGGAAGG - Intronic
1143374428 17:6458902-6458924 AAGGACAGGAAGAAGATGGAAGG - Intronic
1143391418 17:6561243-6561265 AAGGAAGAGGAGAAGGAGGAAGG - Intergenic
1143410849 17:6707504-6707526 AAGGAGGAGAAGGAGGAGGAGGG + Intronic
1143473905 17:7192356-7192378 AAAGCCAAGAAAAAGGAGAAAGG + Intronic
1143701118 17:8660913-8660935 AAGAGAAAGAAGAGGGAGGAAGG - Intergenic
1143980356 17:10863867-10863889 AAGGGGAAAAAGAAAGAGGAAGG - Intergenic
1144053168 17:11515281-11515303 AAAGAAAAGAAGAAAGAGGAAGG + Intronic
1144235673 17:13258100-13258122 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144235679 17:13258127-13258149 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144725593 17:17500454-17500476 AACTTCAAGAAGAAGCAGGAGGG - Intergenic
1145787351 17:27602927-27602949 AAGCCCTAGAAGAAGGTCGAGGG + Intronic
1145833600 17:27937200-27937222 AAGGGCAAGAAGAAAAAGGAGGG - Intergenic
1146208739 17:30925541-30925563 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1146496572 17:33327964-33327986 AAGCCAAAGAAGACTGAGGATGG + Intronic
1146673679 17:34758586-34758608 AGGAGAAAGAAGAAGGAGGAAGG + Intergenic
1146979508 17:37146707-37146729 AAGGGAGAGAAGAAGGAGGGGGG + Intronic
1147152793 17:38528026-38528048 AAATCCAAGAAGAGTGAGGAGGG - Intergenic
1147318244 17:39631337-39631359 AGGTCCAAGAAGAGGGAAGAAGG + Intronic
1147431587 17:40374687-40374709 GAGGACAAAAAGGAGGAGGAGGG - Intergenic
1147456654 17:40542226-40542248 GATGCCAAGAGGACGGAGGAGGG - Intergenic
1147498720 17:40942204-40942226 AAGGAGAAGAAGGAGAAGGAGGG - Intergenic
1147503313 17:40987383-40987405 AAGGCAAAGAAGGAAGTGGAGGG + Intergenic
1147606316 17:41775739-41775761 AAGGACAGGAAGAAGGAAGACGG + Intronic
1147985745 17:44307043-44307065 AAGAGCAAGATGATGGAGGAGGG + Intergenic
1148006770 17:44438569-44438591 AAGACCAAGCAGAAGGATGAAGG + Intronic
1148467564 17:47874023-47874045 AAGAGGAAGAGGAAGGAGGAGGG - Intergenic
1148467576 17:47874075-47874097 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
1149114164 17:53071726-53071748 AAGGAGAAGAAGAAAAAGGAGGG + Intergenic
1149195154 17:54110747-54110769 AAGAAGAAGAAGAAGGAGAAGGG + Intergenic
1149430383 17:56592776-56592798 CCGGCCAAGGAGGAGGAGGATGG + Intergenic
1149470071 17:56909208-56909230 AAGGTCCAGGAGAAGGGGGAAGG + Intronic
1149797906 17:59538419-59538441 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1150139581 17:62716889-62716911 AAGGACAAGCAGCAGGAGGGTGG + Intronic
1150407674 17:64916679-64916701 GAGGCCAAGAGGTGGGAGGATGG + Intronic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150430350 17:65110689-65110711 AAGACAAAAAAGAAGGAGGCCGG - Intergenic
1150465196 17:65386681-65386703 AAGAGAAAGAGGAAGGAGGATGG - Intergenic
1150628600 17:66859822-66859844 AAGGGGGAGGAGAAGGAGGAGGG - Intronic
1150739041 17:67764861-67764883 AAGCCCAAGAGGAATGAGGCAGG + Intergenic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1151743934 17:76001483-76001505 AAGGCCAAGAACAGGGAGACAGG + Exonic
1151745625 17:76010257-76010279 AAGGCCCAGGTGGAGGAGGAGGG - Exonic
1151895322 17:76976574-76976596 AGGGACAAGAAGAAGCAAGATGG + Intergenic
1152000090 17:77639931-77639953 AAGAGGAAGAAGGAGGAGGAGGG - Intergenic
1152362253 17:79838095-79838117 AAGGGCAGGAAGAAAGGGGAGGG + Intronic
1152596643 17:81240984-81241006 CAGGCCAAGAAGACGCTGGAGGG + Exonic
1152863805 17:82710517-82710539 GAGGACAAGAAGGAGGTGGACGG + Intergenic
1153359879 18:4182231-4182253 AAGAACAAGCAGAAGCAGGAAGG + Intronic
1153680639 18:7497346-7497368 AAGGAAGAGGAGAAGGAGGAAGG + Intergenic
1153694921 18:7630290-7630312 AAGCCCCTGAAGAGGGAGGAGGG + Intronic
1153915212 18:9738788-9738810 GAGGCCTAGCACAAGGAGGAAGG - Intronic
1154213967 18:12401927-12401949 AAGGCCCAGAAGCTGGAGGCTGG - Intergenic
1155494898 18:26433116-26433138 AAGGCCAAGGAGCAGGCTGAGGG - Intergenic
1155844307 18:30686355-30686377 GAGGAAAAGAAGAAAGAGGAGGG + Intergenic
1155857432 18:30850569-30850591 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG + Intergenic
1156261287 18:35446844-35446866 TGGGCCAAGAAGGAAGAGGATGG + Intronic
1156281966 18:35648033-35648055 AAGAAGAAGAAGAAGAAGGAAGG + Intronic
1156585644 18:38428073-38428095 AGGGAAAAGGAGAAGGAGGAAGG + Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1156883513 18:42108115-42108137 AAGGAAGAGAACAAGGAGGAGGG + Intergenic
1156964114 18:43069546-43069568 AAGGACAAAAACAAGGAGGTTGG - Intronic
1157030493 18:43900972-43900994 AAGGCTAAGGAAGAGGAGGAAGG - Intergenic
1157078523 18:44495531-44495553 AAGGCTGAGAAGACGAAGGACGG - Intergenic
1157237607 18:45979194-45979216 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1157584204 18:48790892-48790914 ATGGCCCAGCAGAAGGAGAAGGG - Intronic
1157651570 18:49337844-49337866 AAGAACAAGAAGAAGGGGAAGGG + Intronic
1158197057 18:54899642-54899664 AAGAGGAAGAAGAAGAAGGAAGG - Intergenic
1158275297 18:55760519-55760541 AATGGAAAGAAGAAGGAGGAGGG - Intergenic
1158310108 18:56149023-56149045 AAGAGGAAGAAGAAGGAAGAGGG + Intergenic
1158540974 18:58354367-58354389 AAGGACAAGAAGGAAGTGGAAGG - Intronic
1158672154 18:59486076-59486098 AAGGCCAAGATTAAGGAGCAAGG - Intronic
1159015841 18:63101223-63101245 ATGGCCAAGAAAAAGAAGGCAGG + Intergenic
1159271240 18:66153814-66153836 AAGACGAAGAAGGAGGAGGAGGG + Intergenic
1159607445 18:70489773-70489795 GAGGCCACTAAGAAGGGGGAAGG - Intergenic
1159725124 18:71947964-71947986 AAGGAAAAGAGGAAGGAAGAGGG + Intergenic
1160228854 18:77031458-77031480 AAAGCTAAGAAAAAGGAGGCAGG + Intronic
1160820986 19:1057940-1057962 ACGGAGAAGAAGAAGGAGGCTGG - Exonic
1160851361 19:1194514-1194536 CAGGGCAAGAGGCAGGAGGAGGG - Intronic
1161195438 19:2983752-2983774 AGGACAGAGAAGAAGGAGGAGGG + Intronic
1161370603 19:3908843-3908865 AAGGAGGAGAAGGAGGAGGAAGG - Intronic
1161404042 19:4081925-4081947 AGGAGCAAGAAGGAGGAGGAGGG - Intergenic
1161506821 19:4648574-4648596 AAGGCCAACAGGAAGAGGGATGG - Intronic
1161918740 19:7250353-7250375 AAGGGAAAGAGGAAGGAGGAGGG + Intronic
1161973703 19:7597156-7597178 AAGGCCAGGGAGAGGGGGGATGG - Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162176797 19:8836386-8836408 GAGGACAAGGAGGAGGAGGAAGG - Intronic
1162543109 19:11310223-11310245 AAGTGCAGGAAGAAGGAAGAAGG + Intronic
1163083799 19:14964223-14964245 AAGGGCAAGAGGCGGGAGGAAGG - Intronic
1163113042 19:15173001-15173023 AAGAGGAAGAAGAAGGAAGAGGG - Intronic
1163113059 19:15173045-15173067 AAGAAGAAGAAGAGGGAGGAGGG - Intronic
1163134957 19:15303607-15303629 AAAGCCACGAAGAAGGAAAAAGG + Intronic
1163338392 19:16688351-16688373 AAGGCCAAGAAGGCGGATTAGGG + Exonic
1163481884 19:17561433-17561455 ACTTCCAAGAAGCAGGAGGAAGG + Intronic
1163760805 19:19135436-19135458 AAAGGGAAGAAGAGGGAGGAGGG - Intronic
1163813882 19:19452032-19452054 AAGACTCAGAAGTAGGAGGAGGG + Intronic
1164092144 19:21966258-21966280 AATTCTAAAAAGAAGGAGGAAGG - Intronic
1164649906 19:29884233-29884255 AAGGAAAGGAAGAAGGAAGAAGG - Intergenic
1164662060 19:29983292-29983314 AAGACAAAGTAGAAGGAAGATGG - Intronic
1164783236 19:30910160-30910182 AAGGCAAGGAATAAGAAGGATGG + Intergenic
1164847289 19:31444228-31444250 AAGAAGAAGAAGAAGGTGGAAGG + Intergenic
1165251967 19:34546140-34546162 AAGTCCAAGATCAAGGGGGAGGG - Intergenic
1165757933 19:38304902-38304924 AAAGTGAAGAAGAAGGAGAAGGG + Exonic
1166851183 19:45762080-45762102 AAGCCCAAGGAGAAGAAGAAAGG + Exonic
1167214236 19:48153871-48153893 AAGAGGAAGAAGGAGGAGGAAGG - Exonic
1167258653 19:48445069-48445091 AAGACCAAGAAAGAGGAGGTGGG + Intergenic
1167346911 19:48951984-48952006 AAAGCCAAGATAAAGGGGGAGGG - Intergenic
1167579069 19:50331484-50331506 AAGGGGAAGAAGAAGGGGGAGGG - Intronic
1167845913 19:52164018-52164040 AAGGAAAAGAAAAAGAAGGAAGG + Intronic
1167867799 19:52342462-52342484 AAAGCCAAGAAAAAAGAAGAGGG - Intronic
1168240720 19:55087567-55087589 AAGCAAAAGAAGAAGGTGGAAGG + Exonic
1168251571 19:55145308-55145330 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
1168332374 19:55578144-55578166 AAGGCCGAGCAGGAGGAAGAAGG - Exonic
1168543476 19:57231545-57231567 AAGGGGAAGAAGAAAGAGTAAGG - Intronic
1168643451 19:58044974-58044996 AAGAACAAGAAGCTGGAGGAAGG + Intronic
925147447 2:1590731-1590753 AAAGCACAGAAGCAGGAGGAAGG + Intergenic
925751188 2:7091470-7091492 AAGGCCCTGGAGGAGGAGGAAGG + Intergenic
925984389 2:9204307-9204329 AAGGCGAAGAAAAAGGAGGAAGG - Intergenic
926301740 2:11609716-11609738 ATGGTCAGGAAGAAGGAGCAGGG + Intronic
926317524 2:11722034-11722056 AAGGCAGAGAAAAAGAAGGAGGG + Intronic
926334892 2:11855612-11855634 ATGGCAAAGAAGAAGAAGGCAGG + Intergenic
926508513 2:13745018-13745040 AAGGGCAAGATGAAGCAGGGTGG + Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926702000 2:15810065-15810087 GAGGGCAAGAGGAAAGAGGAGGG - Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
926918509 2:17916329-17916351 GAGGCCATGAAGGAGGAAGAGGG + Intronic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
927056793 2:19372992-19373014 AAGGGGAAGAAGAAGGTGGTTGG - Intergenic
927083979 2:19656326-19656348 AGGGCCAACAAGAAAAAGGAAGG + Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927423840 2:22959188-22959210 ATGGCCAAGAAGAAGGCTGAAGG - Intergenic
927684488 2:25161229-25161251 GCGGCCGAGAAGAAGGACGAGGG - Exonic
927689208 2:25195790-25195812 AAGGCCCAGAGGCAGGAGGGTGG - Intergenic
927810855 2:26179566-26179588 GAGGGCAAGGACAAGGAGGAGGG + Intronic
928046141 2:27934426-27934448 AGGCCCAAGAAGAGGGAGAAAGG - Intronic
928274088 2:29883083-29883105 AAGGGAGAGAGGAAGGAGGAAGG + Intronic
928317021 2:30254626-30254648 CAGGCCCAGCAAAAGGAGGAGGG - Intronic
928387317 2:30881474-30881496 AAGTCCTACACGAAGGAGGAAGG + Intergenic
928517342 2:32056103-32056125 AAGGACAAAAAGAAGGAGCTAGG - Intergenic
928533794 2:32219399-32219421 AGGGGGCAGAAGAAGGAGGAGGG - Intronic
928924673 2:36565573-36565595 GAGGTCAGGTAGAAGGAGGAGGG - Intronic
929015018 2:37485283-37485305 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
929237745 2:39624428-39624450 AAGGCAGTGGAGAAGGAGGAGGG + Intergenic
929341552 2:40825008-40825030 AAGGAAAAGAAACAGGAGGATGG + Intergenic
929362151 2:41104531-41104553 AAGGGAAGGAAGAAGGAGAAGGG + Intergenic
929766439 2:44847846-44847868 AAGCCAAAGAAGAAGGGGAAGGG - Intergenic
929766445 2:44847876-44847898 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
929795046 2:45052916-45052938 TAGGCCATGAAGAAGAAGCAAGG + Intergenic
930030629 2:47056221-47056243 AATGCCCAGAAAAAGAAGGAAGG - Intronic
930175042 2:48292966-48292988 AGGGGCAAAAAGAAGGAGGCTGG + Intergenic
930445051 2:51459858-51459880 AGGGCCAAAAAGAAGGAAGCTGG - Intergenic
930535268 2:52637988-52638010 AAGTGGAAGAAGAAGGAAGAAGG - Intergenic
930556787 2:52906260-52906282 AAGGGGAAGTAGAAGGAGGCTGG - Intergenic
930581855 2:53221074-53221096 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG + Intronic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931285766 2:60830338-60830360 CATGCCAGGCAGAAGGAGGAAGG + Intergenic
931339244 2:61382711-61382733 AAGCCTAAGAAGATGGAGAAAGG - Intronic
931960965 2:67482449-67482471 ACGCCCAAGGAGAAGGAGAAAGG - Intergenic
931975414 2:67638654-67638676 AAAGCTAAAAACAAGGAGGAAGG - Intergenic
931992793 2:67807873-67807895 AAGGGGAAGAAGAAGAAGAAGGG - Intergenic
932319497 2:70811268-70811290 AAGGCCAAGATGAAGGTGTATGG - Intronic
932337982 2:70941930-70941952 AAGGCCAAGGAGAGGGTGGAAGG + Exonic
932450886 2:71810169-71810191 AAGGGAAAGAAAGAGGAGGAGGG + Intergenic
933309591 2:80643817-80643839 AAGGCCAGGAAGAACAAGGAAGG + Intronic
933366017 2:81355069-81355091 AAGGCAAATAAGAAGGAGGGAGG + Intergenic
933698489 2:85237758-85237780 AGGGGCATGAAGAAGGAGGGAGG + Intronic
933895373 2:86806437-86806459 CAGGCCAAGGACAAGGAGGAAGG - Intronic
934122886 2:88857215-88857237 AAAGCCAAGGAGGAGGAGGGGGG + Intergenic
934653224 2:96104137-96104159 AAGGAAAAGGAGGAGGAGGAGGG - Intergenic
935670647 2:105554137-105554159 AAGGCCTGGAAGAAATAGGAAGG + Intergenic
935897721 2:107755637-107755659 CTGGCCAAGAAGATGGAAGAAGG - Intergenic
935938261 2:108209825-108209847 AGTGCCAGGAAGAAGGAAGAAGG - Intergenic
936495554 2:113017494-113017516 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
936977236 2:118232376-118232398 AAGGAGAAGAGGAAGGAAGAGGG - Intergenic
937062779 2:118992696-118992718 AAGGAAAGGAAGAAGGAGAAAGG - Intronic
937130908 2:119512340-119512362 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
937139997 2:119591726-119591748 AAGGCCAGGAAGAAGTCAGATGG + Intronic
937217396 2:120321358-120321380 AACTCGAAGAAGAAGGAGGAGGG - Intergenic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937356608 2:121201841-121201863 AAGGGACAGATGAAGGAGGAAGG + Intergenic
937357703 2:121208771-121208793 AAGGGACAGATGAAGGAGGAAGG + Intergenic
937470328 2:122168876-122168898 AAGGCAAAGAGGAAAGAGCAAGG - Intergenic
937486203 2:122317482-122317504 AAGGCCATGAAGAAAAAGGTAGG + Intergenic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938154502 2:128921411-128921433 AAAGAAAAGGAGAAGGAGGAAGG - Intergenic
938272825 2:129990256-129990278 AAGGAAGAGAAGGAGGAGGAGGG + Intergenic
938443405 2:131355852-131355874 AAGGAAGAGAAGGAGGAGGAGGG - Intergenic
938670384 2:133580976-133580998 AAGGGAAAGAGGAAGGAGGTTGG - Intergenic
938985915 2:136576066-136576088 AAGGCAAAGAAGAAAGAGAAGGG + Intergenic
939438360 2:142208267-142208289 AAGGACAAGAAGAGTGAGAAAGG - Intergenic
939478334 2:142715493-142715515 AAGGCTTTGAAGATGGAGGAAGG - Intergenic
939719795 2:145634559-145634581 AAGGCATGGAAGAAGGAGCATGG + Intergenic
939743556 2:145940205-145940227 AAACCAAATAAGAAGGAGGAGGG - Intergenic
939959508 2:148553962-148553984 AAGGCAAGGAAGAAAGAGGGAGG + Intergenic
940037794 2:149329504-149329526 AAATCCAAGGAGAAGGTGGAGGG + Intergenic
940092845 2:149940818-149940840 AAGGAAGAGAAGAAAGAGGAAGG - Intergenic
940164056 2:150748397-150748419 AAGAAAAAGAAGAAAGAGGAAGG - Intergenic
940255619 2:151725162-151725184 AAGGCCAAGAAGCAGCAGGCTGG - Intronic
940609837 2:155976295-155976317 AAGGCCAAAAATAAGGAGAAGGG + Intergenic
940888449 2:159011923-159011945 GTCCCCAAGAAGAAGGAGGAGGG + Intronic
940939208 2:159538455-159538477 TTTGCCAAGAAGCAGGAGGAAGG - Intronic
941067387 2:160919005-160919027 AAGTCAAACAAAAAGGAGGATGG + Intergenic
941325008 2:164103530-164103552 AAGACAAGGAAGAAGGGGGATGG + Intergenic
941474873 2:165938711-165938733 AAAGGCAGGAAGAAGGAGGGAGG + Intronic
941999703 2:171633741-171633763 AAGGCAAAGAAAAGGAAGGAAGG - Intergenic
942570907 2:177313364-177313386 AAGGGAAAGAAGAGGAAGGAAGG - Intronic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
942854187 2:180526159-180526181 AAGGCCCAGAGGCAGGAGCAAGG + Intergenic
943065760 2:183084477-183084499 AAGGCCCAGAAGCAAGAGAAAGG + Intronic
943612291 2:190047286-190047308 ATGGGAAAGAAGAAGGAAGAAGG - Intronic
944058617 2:195548305-195548327 AAGGAAAGGAAGAAGGAAGAGGG + Intergenic
944246485 2:197535591-197535613 AAGGCCAAGATGAAGGTGTGTGG + Exonic
944467018 2:200012112-200012134 CAGGCCAAAAAGAAGGTGTATGG + Intergenic
944488297 2:200230430-200230452 AAGACCATGAAGGAGAAGGAGGG + Intergenic
944547827 2:200815063-200815085 AAAGCCAAGAGGCAGTAGGAGGG + Intronic
944686325 2:202121087-202121109 AAGTCCAAGGAGAACGAGGAGGG - Intronic
945648487 2:212531461-212531483 AGGGCCATGATGAAAGAGGATGG + Intronic
945814055 2:214582322-214582344 AAGTCCAGGAAGAAGAATGAGGG + Intergenic
945911493 2:215655148-215655170 GAGGCCAAGAAGAAGCTGAACGG - Intergenic
946117114 2:217472787-217472809 GAAGCCAAGAAGAAAAAGGAGGG - Intronic
946410907 2:219514773-219514795 AAACCCAAGGAGAAGGAGGCAGG + Exonic
946460035 2:219860810-219860832 AAGGAAAAAAAGAAGGAAGAAGG + Intergenic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946621334 2:221566935-221566957 AAGGAGAAGGAGAAGGAGAAGGG + Intronic
946756332 2:222951532-222951554 AAAGCAAAGAAAAAGCAGGAAGG - Intergenic
947290223 2:228565515-228565537 AAGGCAAAGAAGATTGAGAAGGG + Intergenic
947295663 2:228627759-228627781 AAGGAGAAGAAGAAGAAGGAGGG - Intergenic
947517501 2:230819758-230819780 AAGGCCAATAGGATGCAGGAAGG - Exonic
947821571 2:233075076-233075098 GAGGCAAAGAAGAGGCAGGAAGG - Intronic
947830187 2:233134144-233134166 AAAGTCAAGGAGGAGGAGGAAGG + Intronic
948238175 2:236406245-236406267 GAGGGCAAGAAGAAGGCGCACGG - Intronic
948336402 2:237210817-237210839 AAGGGCAAGGACATGGAGGAAGG + Intergenic
948428354 2:237902408-237902430 AAGGACAGGGAGATGGAGGAGGG + Intronic
948488304 2:238295259-238295281 AAGGAGAAGAAGAAGAAAGAAGG - Intergenic
948538992 2:238672320-238672342 AAGGAGGAGAAGAAGGAGAAGGG - Intergenic
948612117 2:239176374-239176396 AAGGCCAGGCAGAGGGAGGGAGG - Intronic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1169118830 20:3083539-3083561 AGGGCGAGGAGGAAGGAGGAAGG - Intronic
1169172970 20:3480420-3480442 AACTCCCAGAAGATGGAGGATGG + Intronic
1169366558 20:4997358-4997380 AAGGCCCTGAGGCAGGAGGAGGG - Intronic
1169674980 20:8143237-8143259 AAGGCTGAGAAGAAGTAGGTAGG - Intronic
1169792364 20:9425025-9425047 AAGACAAAGGAGAAGGAGGAAGG - Intronic
1169979708 20:11370712-11370734 ATGGGCAAGAAGAAAAAGGATGG + Intergenic
1170034311 20:11973852-11973874 AAGAGGAGGAAGAAGGAGGAAGG + Intergenic
1170519986 20:17175114-17175136 AAGGCAAGGAACATGGAGGATGG + Intergenic
1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1170925743 20:20721790-20721812 AAGGCAAAGAAAAAGGACAAAGG + Intergenic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171149083 20:22810897-22810919 AAGGCCAAGAAGGGGCAGAAGGG - Intergenic
1171168671 20:22995881-22995903 ATGGCCAAGCAGAGGGAGGGAGG - Intergenic
1171332492 20:24352749-24352771 AAAGCCAAGAAGAAGGAAAAAGG - Intergenic
1171349672 20:24492766-24492788 AAGGCAAAGGGGAAGGAAGATGG - Intronic
1171796754 20:29572446-29572468 AAGGCAGAGGAGGAGGAGGAAGG + Intergenic
1171851493 20:30311720-30311742 AAGGCAGAGGAGGAGGAGGAAGG - Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1172174505 20:32963986-32964008 AAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1172471154 20:35197430-35197452 AGGGCCAAGAAGAGGGAGAAAGG - Intergenic
1172536912 20:35681004-35681026 AAGGAAAAGAGGAAGGAGAAGGG - Intronic
1172660325 20:36563682-36563704 GAGGCCAAGATGATGGAGAATGG + Intergenic
1172689987 20:36783609-36783631 AAGGCAGAGAGGCAGGAGGAAGG + Exonic
1172762813 20:37333897-37333919 AAGGCCAAGGGGAAGGGGAAGGG + Intergenic
1172771445 20:37384661-37384683 AAGCCCAAGAAGAAGAAGGGCGG + Intronic
1172801006 20:37576198-37576220 GAGACCAAGAGCAAGGAGGAAGG - Intergenic
1172811258 20:37649945-37649967 AAGGAAAAGAAGAAGGGAGAAGG + Intergenic
1172889043 20:38250869-38250891 AAGGGCAAGAAGAAGAAGGTAGG + Intronic
1173112405 20:40204604-40204626 AAAGAAAGGAAGAAGGAGGAAGG - Intergenic
1173538234 20:43831985-43832007 AAGACCATGAAGATGGCGGACGG - Intergenic
1173554055 20:43953052-43953074 ACGGCTATGAAGATGGAGGAAGG + Intronic
1173659041 20:44720279-44720301 GAGGCCAAGAAGGGAGAGGAGGG - Intronic
1174066660 20:47870736-47870758 AAGGCAAAGAGGAGGGAGGAAGG + Intergenic
1174265129 20:49325767-49325789 GAGGGCAAGAAGGAGGAGGGAGG - Intergenic
1174709531 20:52690281-52690303 AAGGAGAAGAAAAAGGAGAAGGG - Intergenic
1175142168 20:56869018-56869040 AATGCCAAGCAGAACCAGGAAGG + Intergenic
1175647619 20:60688151-60688173 GAAGCCTACAAGAAGGAGGAAGG + Intergenic
1175657774 20:60786927-60786949 AAGGGGAGGAGGAAGGAGGAGGG - Intergenic
1175665230 20:60852946-60852968 TAGGCCAAGAAGAGGGAGGAGGG + Intergenic
1175703789 20:61160589-61160611 CAGGCCAAGATGAATCAGGAGGG - Intergenic
1175764141 20:61581458-61581480 CTGGCCATGAAGATGGAGGAGGG - Intronic
1175889749 20:62310876-62310898 AGGGCCGAGAAGAAGGAAGGTGG - Intronic
1176377274 21:6092834-6092856 AAGGCCACCAAGGAGCAGGAAGG - Intergenic
1176513650 21:7767340-7767362 AAGGGAAAGAGGAAGGGGGACGG - Intronic
1176918982 21:14663630-14663652 AAGGACCAGAAGGAGGAGGAAGG + Intergenic
1177095134 21:16823266-16823288 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1177661927 21:24095842-24095864 TAGGTCTAGAAGAAGGAGGCTGG - Intergenic
1177744949 21:25200772-25200794 ATGGCCAAGTAGAAGGTTGAAGG - Intergenic
1178002337 21:28176392-28176414 AATGAAAAGAAGAAGAAGGAAGG + Intergenic
1178258332 21:31075611-31075633 GTGGCCAAGAAGAAGCAAGATGG - Intergenic
1178325445 21:31641768-31641790 AAGGGCAAGAAGAAGAGGGTGGG + Intergenic
1178455054 21:32741535-32741557 GAGGCCAAGAAGAATCTGGACGG - Intronic
1178598317 21:33974660-33974682 AAGGAAAGGAAGAAGGGGGATGG - Intergenic
1178647763 21:34397864-34397886 AAGGGAAAGAGGAAGGGGGACGG - Intronic
1178921973 21:36744701-36744723 ATGGCAAAGAAGATGGATGAAGG - Intronic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179238311 21:39566557-39566579 AGGGACAAGAAGAAGCAGGAGGG - Intronic
1179540617 21:42081245-42081267 GAGGCCCCGAGGAAGGAGGAGGG + Intronic
1179638904 21:42734021-42734043 AAGGCAACGGAGAAGCAGGAGGG - Intronic
1179681158 21:43022212-43022234 AAGGCCGAGGAGGAGGAGGCTGG - Intronic
1179746201 21:43445410-43445432 AAGGCCACCAAGGAGCAGGAAGG + Intergenic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180031039 21:45208211-45208233 TAAACCAAGAAGAAGGAGCAGGG + Intronic
1180835013 22:18925475-18925497 GAGGCCATGAAAAAGGAGCAGGG + Intronic
1181054628 22:20254893-20254915 AAGGCCATGAAAGAGAAGGAAGG + Intronic
1181525547 22:23483272-23483294 AAGGCAAAGAAAGAGCAGGAAGG + Intergenic
1181615621 22:24052220-24052242 AGGGCTAAGTAGAAGCAGGAGGG + Intronic
1181720228 22:24768582-24768604 AAGGAAAACAAGAAGCAGGAAGG + Intronic
1181850072 22:25743583-25743605 AAGGCCAAGTGGGTGGAGGAGGG + Intronic
1181886062 22:26023418-26023440 AAGGCATAAAAGTAGGAGGAAGG - Intronic
1181959976 22:26616066-26616088 GAGGAGAAGAAGGAGGAGGAGGG + Intronic
1181977211 22:26738473-26738495 AAGGAGGAGAACAAGGAGGAGGG - Intergenic
1182005564 22:26956623-26956645 AAGCCCAGGAAGCAGGAAGAAGG - Intergenic
1182099525 22:27648162-27648184 AAGAAGGAGAAGAAGGAGGAGGG + Intergenic
1182126069 22:27816756-27816778 AAGGATCAGAAGAGGGAGGAGGG - Intergenic
1182466783 22:30521859-30521881 AAGGAAAAGAAAAAGAAGGAAGG - Intergenic
1182623685 22:31631024-31631046 AAGGCCAGGGAGAAGGGGAAGGG + Intronic
1182752249 22:32651113-32651135 AAGGCCAAGAAGACAGACAAGGG + Intronic
1182754582 22:32668516-32668538 AAGGAGAAGGAGAAGGAGAAAGG - Intronic
1182886407 22:33777666-33777688 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1182960592 22:34470883-34470905 AAGGATAAGAATAAGAAGGAGGG - Intergenic
1183226748 22:36555613-36555635 AAGGGCAAGGAGAAGGAAAAGGG - Intergenic
1183498343 22:38163220-38163242 AAGGCCCAGAGGACAGAGGAGGG - Intronic
1183804179 22:40194166-40194188 AAGGAAAAGAAGAAGGAGTCTGG + Intronic
1184001415 22:41676813-41676835 AAGGCAAAGAAAAAGGCTGACGG - Intronic
1184583638 22:45433454-45433476 AAGGCAAAAAAGAAGGGGGTCGG + Intergenic
1184733020 22:46381378-46381400 AATGGCAGGAAGAAGGAGGGCGG + Intronic
1185004556 22:48268061-48268083 CCGGCCATGAGGAAGGAGGAGGG + Intergenic
1185136674 22:49077381-49077403 ATGCCCAAGAAGCAGCAGGAAGG - Intergenic
1185168816 22:49279380-49279402 AAGAGGAAGAAGAAGGAGAAGGG - Intergenic
1185361940 22:50413673-50413695 AAGGGGAAGAAGGAAGAGGAGGG - Intronic
1203285102 22_KI270734v1_random:150774-150796 GAGGCCATGAAAAAGGAGCAGGG + Intergenic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949665736 3:6337489-6337511 AAGATAAAAAAGAAGGAGGAGGG + Intergenic
950174488 3:10863238-10863260 AGGGCTAAGTAGAAGGAGGAAGG + Intronic
950215028 3:11153359-11153381 GAGGCCAAGAAAAAGGACCATGG + Intronic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950579699 3:13854135-13854157 AAGCCTGAGAAGAGGGAGGAAGG + Intronic
950904665 3:16527106-16527128 ATTGCAGAGAAGAAGGAGGAGGG + Intergenic
951766562 3:26205897-26205919 AAAGCCAACTAGAAGGTGGAGGG - Intergenic
951881178 3:27483380-27483402 CAGGCCAAGTAGAAGGAGGAGGG - Intronic
952089295 3:29865015-29865037 AAGGGGAAGGAGAAGGAGGGAGG + Intronic
952574285 3:34755919-34755941 AAGGGCAAAAAGAACCAGGAAGG - Intergenic
952697897 3:36291507-36291529 AAGGCCCAGAAGAAAGGGGTGGG - Intergenic
952723881 3:36561616-36561638 GAGGTCTAGAAGAAGAAGGATGG - Intergenic
952932016 3:38367825-38367847 AATGCCAAGGAGATAGAGGAAGG + Intronic
953145539 3:40271164-40271186 GAGACCAAGCAGAAAGAGGAAGG + Intergenic
953299104 3:41753626-41753648 AAGGCTCAGAAGGAGGAGCAGGG - Intronic
954000135 3:47550011-47550033 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
954038456 3:47866404-47866426 GAGGGGAAGAAAAAGGAGGAAGG + Intronic
954287781 3:49631012-49631034 AAGGACAGGAAGAAGGGAGAGGG - Intronic
954330447 3:49887201-49887223 AAGGGCAGGAACAAGGTGGAGGG + Exonic
954440831 3:50521151-50521173 AAGGCCAAGAGAGAGGAGGAGGG + Intergenic
954450939 3:50571353-50571375 GAGGACAGGAAGAGGGAGGAGGG + Intronic
954524862 3:51261260-51261282 GAGGGCAAGCAGAAGGAGGGTGG + Intronic
954596513 3:51829934-51829956 AAGGCCCAGGAGAATGAGGAGGG + Intronic
954653347 3:52178612-52178634 AAGGACAATAAGGAGGAGGCTGG + Intergenic
954876509 3:53806143-53806165 AGGGAAAAGAAGGAGGAGGAGGG - Intronic
954911460 3:54114263-54114285 AACTCCAAGGAGAAGGAGGCTGG + Intergenic
955006845 3:54976597-54976619 AAGAAGAAGAATAAGGAGGATGG - Intronic
955073532 3:55591761-55591783 AAGGACAAGAATAATGGGGATGG - Intronic
955307393 3:57848145-57848167 GAGGAGAAGAAGAAGGAAGAAGG - Intronic
955342864 3:58138884-58138906 ATGGCCATGAAGATGGAAGAAGG - Intronic
955389457 3:58510079-58510101 AAGGCCAGGAGGAAGAAGAATGG - Intronic
955470462 3:59281636-59281658 ATGGGGGAGAAGAAGGAGGAAGG - Intergenic
955603441 3:60672774-60672796 AAGGCAAGAAAGAAGGAAGAAGG - Intronic
955643864 3:61115402-61115424 AAGGCCAAGCACAAGGAGGCTGG + Intronic
955658607 3:61271864-61271886 AAGCTCAAGAAGAGGCAGGAAGG + Intergenic
955863386 3:63356025-63356047 AAGGCCAAGGATGAGTAGGAGGG - Intronic
955961727 3:64347557-64347579 AAGGAAAAGAAAAACGAGGACGG + Intronic
956055182 3:65291082-65291104 AAGGCCATGGTGAAGGAGGGGGG - Intergenic
956361419 3:68452041-68452063 AAGGCCAAGAGAGGGGAGGATGG + Intronic
956587879 3:70883459-70883481 CAAGCCAAGAAAAAGCAGGAAGG + Intergenic
956768556 3:72505293-72505315 AGGACAAAGGAGAAGGAGGAAGG + Intergenic
957154378 3:76528942-76528964 TAGGCCAAGTAGAAAGAGGTGGG + Intronic
957582535 3:82092961-82092983 AAGTACTAGAAGGAGGAGGAAGG - Intergenic
957764872 3:84610526-84610548 AAGGGGAAAAAGAAGGAAGAGGG + Intergenic
957899945 3:86476258-86476280 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
958157780 3:89776368-89776390 AAAGCAAAGAAGAAGAAAGAAGG - Intergenic
958455478 3:94325913-94325935 CAAGGCAGGAAGAAGGAGGAAGG + Intergenic
958481359 3:94649078-94649100 AAGGTCAGGAAAATGGAGGATGG + Intergenic
958537438 3:95423247-95423269 AAGACCAAGAAGAGAGAGAAAGG + Intergenic
958923228 3:100129348-100129370 AAGGGGAAGAAGAAGGTTGAAGG + Intronic
958932027 3:100217455-100217477 AACTCCAAGAAGTAGGAGGAGGG + Intergenic
959189056 3:103086346-103086368 AAAGCCAAATAGAAGGAAGAAGG + Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959354072 3:105303471-105303493 TAGGCCAAAAAGAAAGAGAAAGG - Intergenic
959560323 3:107772341-107772363 AAGACCTGGAAGAAGGAGGAAGG - Intronic
959566073 3:107834487-107834509 AAGACTAAGAAGAAGCAGGGGGG + Intergenic
959833662 3:110893272-110893294 AAGGACAAAAAGAAGGAGGAAGG - Exonic
959963810 3:112332213-112332235 AAGACGAAGGAGGAGGAGGAGGG + Intergenic
960123261 3:113969041-113969063 AAAGCAAAGAAAAAGGGGGAGGG + Intronic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
960792550 3:121449799-121449821 AAGGACAAGAAGAGGGATGTTGG - Intronic
960846590 3:122009613-122009635 AGGGCCAAGGAGAAAGAGGTTGG + Intronic
960884111 3:122376810-122376832 AAGGGCAAGGGTAAGGAGGAAGG + Intronic
961262408 3:125612966-125612988 AAGGGCAAGAACAATGAAGAGGG - Intergenic
961292265 3:125857314-125857336 AAAGCCAAAAACCAGGAGGAAGG + Intergenic
961362043 3:126374091-126374113 AAGGCCTTGAGGAACGAGGATGG - Intergenic
962338253 3:134557897-134557919 AATTCCAAGAAGGTGGAGGAAGG - Intronic
962748618 3:138416691-138416713 AAGTGAAAGAAAAAGGAGGAGGG - Intergenic
962927928 3:140012204-140012226 AATGCCAAGAGAAGGGAGGAAGG + Intronic
962937331 3:140092919-140092941 ATGGCCAAGAACAAGGATGAGGG + Intronic
964158549 3:153617309-153617331 AAGGAGAAGAGGAAGGAGGCAGG - Intergenic
964168674 3:153739813-153739835 AACGACAGGAAGAATGAGGAGGG + Intergenic
964763156 3:160153377-160153399 AGGGGCAAGAGGAGGGAGGAAGG - Intergenic
964886461 3:161489199-161489221 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
965114197 3:164466423-164466445 AATTCCAAGAAAAAAGAGGAGGG - Intergenic
965172184 3:165279927-165279949 GAGGTGAAGAAGAAGGAGGAGGG - Intergenic
965329155 3:167348379-167348401 AAAGAAAAGAAGAAGGAGGGAGG + Intronic
965440721 3:168710402-168710424 TAGGCTAAGAAGAAGAAGGAGGG - Intergenic
965793558 3:172414286-172414308 AAGGCCAGAAGGATGGAGGATGG + Intergenic
965888099 3:173474129-173474151 AAGGAAAAGGAAAAGGAGGAGGG - Intronic
966396327 3:179507405-179507427 AAGGAAGGGAAGAAGGAGGAAGG + Intergenic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966562547 3:181339628-181339650 AAAGCCAAGAATAAGCATGAAGG - Intergenic
966564433 3:181360760-181360782 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
966568641 3:181413423-181413445 AAGGGCAAGCAGAGGAAGGAAGG + Intergenic
966744160 3:183259835-183259857 GAGACCAAGAAGAAGAAGGAGGG + Intronic
966895104 3:184439078-184439100 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
966928156 3:184658887-184658909 AAGGCCTGGGAGAGGGAGGAGGG - Intronic
967360492 3:188624749-188624771 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
967563251 3:190942754-190942776 AAGGGAAATAAGAAGGAGGGAGG - Intergenic
967627126 3:191699735-191699757 AAGGAAGAGAAAAAGGAGGAGGG + Intergenic
967778236 3:193406835-193406857 AAGGCCCAGGAGAAGGCAGAAGG + Intronic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
967893559 3:194380272-194380294 AAGGACAAGAAGGAGGCAGAAGG + Intergenic
967987683 3:195107507-195107529 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
968239640 3:197065567-197065589 AAGGACAATAATATGGAGGATGG + Intronic
968451618 4:678667-678689 AAGACCAAGAAGAAGGAAGGGGG + Exonic
968612309 4:1562865-1562887 AGGGCCGAGCAGAAGGAGGGTGG + Intergenic
968669522 4:1841531-1841553 AAGAACAAGAAGCTGGAGGAAGG - Exonic
968808600 4:2790160-2790182 AAGGCCAAAGAGAAGGGGGCCGG - Intergenic
968876535 4:3270586-3270608 AAGGACAAGAGGAAGGAGTGAGG - Intronic
969107882 4:4821609-4821631 AGGGCTCAGAAGAAGAAGGAAGG + Intergenic
969142549 4:5091776-5091798 ATAGCCAACAAGAAGGAGTAGGG + Intronic
969164902 4:5299092-5299114 AAGGGCAAGCAGAAGCAGGGTGG - Intronic
969345086 4:6564918-6564940 AAGGCCAAGAAGGAAGAGGGAGG - Intergenic
969372633 4:6743515-6743537 AAGAAAAAGAAGAAGGGGGAGGG - Intergenic
969410093 4:7022326-7022348 AAGGCCCAAAAGATGCAGGATGG + Intronic
969576832 4:8040971-8040993 GAGGCCAAGAGGAAGCAGCATGG + Intronic
969979526 4:11140470-11140492 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
970569350 4:17364590-17364612 AAGATCAATAAGTAGGAGGAGGG + Intergenic
970573358 4:17404285-17404307 AAGGGAAGGAAGAAGGAGAAAGG + Intergenic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971112356 4:23602552-23602574 AAGGAAAGGAAGAAGGAAGAAGG + Intergenic
971142474 4:23939116-23939138 AAGGAAAAGAAGAAGGAAAAAGG + Intergenic
971420251 4:26467893-26467915 GAGGGGAAGAAGAAGAAGGAGGG + Intergenic
971734245 4:30425641-30425663 AAGGACAGGAGGAAGGAAGAAGG + Intergenic
973064874 4:45776853-45776875 AAGAACAAAAAGAAGGAAGAAGG - Intergenic
973130615 4:46643803-46643825 AAGGCAAGGAAGATGGAGAATGG - Intergenic
973284122 4:48396262-48396284 AAGGTAAAGAAGGGGGAGGAGGG + Intronic
973832603 4:54776791-54776813 AGAGCCAAGAAATAGGAGGAAGG + Intergenic
974158355 4:58103483-58103505 AAGGCCAAGAGGAAGGGCAAAGG - Intergenic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974323535 4:60385358-60385380 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
974359979 4:60865047-60865069 AAGGACAAGAAGAAGGGTCATGG - Intergenic
975028215 4:69578513-69578535 AAGGAGAAGAAGAAGAAAGAAGG - Intergenic
975149506 4:71005260-71005282 GAGGCCAAGCAGAAGCAGGGTGG - Intronic
975202471 4:71607759-71607781 AAGCCCAAGCAGCATGAGGAGGG - Intergenic
975321634 4:73015174-73015196 AATGTAAAGAAGAAGGAGAAAGG + Intergenic
975639713 4:76487871-76487893 AAGGCCAAAAGAAAGAAGGATGG - Intronic
975964103 4:79948746-79948768 AATGCAAAGAAGGAGAAGGAAGG + Intronic
976103629 4:81593047-81593069 AAGAACAAGCAGAAGGAGCAGGG + Intronic
976400273 4:84598899-84598921 AAGGACAAGAACAAGGACAAGGG - Intronic
976559152 4:86480981-86481003 AAGGCCAAGAAGAATCTGAATGG - Intronic
976561967 4:86511893-86511915 AAGGAGAAGAATGAGGAGGAAGG + Intronic
976894839 4:90097036-90097058 AATGCCAAGAAAAAGTAAGAAGG + Intergenic
977031013 4:91883193-91883215 TACCCCAACAAGAAGGAGGAGGG + Intergenic
977066654 4:92325388-92325410 AAGGCACAGAAGAAAGGGGAAGG - Intronic
977328353 4:95605504-95605526 ATGACAAAGAAGAAGGAGAACGG - Intergenic
977917972 4:102614560-102614582 GAGGCCAAGCAGAGGGTGGAAGG - Intronic
978400725 4:108327707-108327729 AAGGAGAAGAAGAAGGAAGTAGG - Intergenic
978553193 4:109950019-109950041 AAGGCCCAGAAGAAGGACCAGGG - Intronic
978566666 4:110089855-110089877 AAGGAAAAGAAAGAGGAGGAAGG + Intronic
978572786 4:110157121-110157143 AAGGCCAAGAAGAAGGAGGAGGG + Intronic
978835616 4:113146012-113146034 TAGGCCACAAAGGAGGAGGAAGG + Intronic
978858321 4:113418646-113418668 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
979278612 4:118839907-118839929 AAGGCCAAAAAAAAGGCTGAAGG + Intergenic
979558945 4:122080470-122080492 AGGGGAAAGAAGAAAGAGGAGGG + Intergenic
980030988 4:127830034-127830056 AAGTCAAAGAAGTGGGAGGATGG - Intronic
980454557 4:133022493-133022515 AAGCCGAAGAAGAAGGAAGCTGG + Intergenic
980533693 4:134087790-134087812 AAGGCCAGGAGGAAGGAAGAAGG - Intergenic
980689893 4:136281524-136281546 AAGGACAAGAAGAAGAAGGTGGG + Intergenic
980833034 4:138154741-138154763 AAGAAGAAGAAGAAGAAGGATGG - Intergenic
981305719 4:143244971-143244993 AAGGCAAAGAATAAGGTTGATGG - Intergenic
981562288 4:146061255-146061277 AAAGGAAGGAAGAAGGAGGAAGG - Intergenic
981735206 4:147942581-147942603 AAGGGGCAGGAGAAGGAGGACGG - Intronic
981769357 4:148289771-148289793 AAGGAAAAGAAAAGGGAGGAAGG - Intronic
982109810 4:152043859-152043881 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
982112309 4:152068004-152068026 AAGGCCAAGGAGTAGGAAGGTGG - Intergenic
982133926 4:152256191-152256213 AATGCCAGGATGAAGTAGGAGGG - Intergenic
982255973 4:153452142-153452164 AAGGGCAAGATGTAGGAGAAAGG - Intergenic
982316527 4:154037546-154037568 ATGGCAAAGGAGAAGGAGGTTGG - Intergenic
982725682 4:158903272-158903294 GAGGGCAAGTAGAAGGAGGGTGG - Intronic
982870374 4:160572655-160572677 AAGCCCAAGAAAGAGGAGGAAGG + Intergenic
983670424 4:170231010-170231032 AAGTCCTTGAGGAAGGAGGATGG + Intergenic
984601572 4:181732982-181733004 AAGGAAAAGAAGGAGGAGAATGG + Intergenic
984703982 4:182834573-182834595 AGGGGAAAGGAGAAGGAGGAGGG - Intergenic
984725165 4:183013456-183013478 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
984908811 4:184652961-184652983 AAGGGAAAGAAGAGGGAGGGAGG + Intronic
984908826 4:184653020-184653042 AAGGGAAAGAAGAGGGAGGGAGG + Intronic
985679992 5:1250920-1250942 AAAGAGAAGAAGAAGGAAGAAGG - Intergenic
986016395 5:3761319-3761341 AAGGCCAGGGAGATGGAGGGAGG - Intergenic
986016409 5:3761374-3761396 AAGGCCAGGGAGATGGAGGGAGG - Intergenic
986016440 5:3761525-3761547 AAGGCCACGGAGATGGAGGGAGG - Intergenic
986210187 5:5664760-5664782 ATGGCCAAGGAGAAGAGGGAGGG + Intergenic
986221782 5:5774973-5774995 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
986390881 5:7287240-7287262 AAGTCAAGGAGGAAGGAGGAGGG - Intergenic
986415768 5:7526297-7526319 AAGGACAAGAAGAAAAGGGAAGG + Intronic
986439315 5:7764876-7764898 AATGCAAAGAAGACGGAGGAAGG + Intronic
986837781 5:11660214-11660236 AAGGCCATGAAAAAGGATGGGGG + Intronic
986946669 5:13029303-13029325 AAGGGGAAGAAGAAGGGGAAGGG + Intergenic
986946681 5:13029336-13029358 AAGGGGAAGAAGAAGGGGAAGGG + Intergenic
987011455 5:13770329-13770351 AAGGGCAAGAAGAGGGAAGAGGG + Intronic
987949108 5:24653245-24653267 AATCCCCAGAAGAAGGACGATGG + Intergenic
988089602 5:26519532-26519554 AGGGAGAAGAAGGAGGAGGAGGG + Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988211990 5:28215862-28215884 AAGGAGGAGAAGAAGGAGGTGGG - Intergenic
988222805 5:28370953-28370975 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
988297839 5:29390008-29390030 AAGGTCATGGAGGAGGAGGAGGG - Intergenic
988494375 5:31732498-31732520 AAGGCTGAGCAGAAGGAGGTGGG + Intronic
988774594 5:34466616-34466638 AAGGTCAGGAAAATGGAGGATGG - Intergenic
988914656 5:35880402-35880424 AAGAACAAGAAAAAGTAGGAAGG - Intergenic
989151317 5:38302387-38302409 AAGGTCATGGAGCAGGAGGATGG - Intronic
989152278 5:38311790-38311812 AAGGCAAAGAAACAGAAGGAAGG + Intronic
989983737 5:50672037-50672059 AAGGCTCAGGAGAAAGAGGAAGG - Intronic
990115154 5:52380749-52380771 AAGGCCAGGAAGAAGAGGGAGGG - Intergenic
990224986 5:53640319-53640341 AAGGTCCAGAAGGAAGAGGAAGG + Intronic
990537992 5:56742731-56742753 AAGGAGAAGAAGAAGAAGGGGGG - Intergenic
990596142 5:57314383-57314405 GAAACCAAGAAGAAGGGGGATGG - Intergenic
990628446 5:57640856-57640878 AAGGAAGAGAAGAAGGATGATGG - Intergenic
990974787 5:61549905-61549927 AAGGCCAGGAAAAATCAGGAAGG - Intergenic
991360451 5:65814258-65814280 GAGGTAAAGAAGAAGGACGAGGG - Intronic
991590202 5:68243129-68243151 AAGGCCACGATGAAAGAGTAAGG + Intronic
991918119 5:71625046-71625068 AAGACCAAGATGAGGGAGGCAGG - Intronic
992079120 5:73217349-73217371 ATGGCCCAGGAAAAGGAGGAGGG + Intergenic
992162611 5:74017325-74017347 AATCCCCAGAAGAAGTAGGAAGG - Intergenic
992384828 5:76274642-76274664 AAGGCCAAGTAGTAGGTGGAGGG - Intronic
992540585 5:77760379-77760401 AAGGAAAGGAAAAAGGAGGAAGG - Intronic
992564556 5:77985026-77985048 AAAGCCTCAAAGAAGGAGGATGG - Intergenic
992629661 5:78667956-78667978 AAGGGGAAGAAAAAGGAGGAGGG - Intronic
992685426 5:79194868-79194890 AAGGCCCAGAAGTACTAGGAAGG + Intronic
993012669 5:82501263-82501285 AAGGTGCAGAAGAAGGTGGAAGG - Intergenic
993247130 5:85465420-85465442 AAGGACAAGAAGAAGGTGGTAGG - Intergenic
993542621 5:89171404-89171426 AAGGCCAAGATGAGAGAGAAGGG + Intergenic
993875821 5:93305505-93305527 AAGGAGAAAAAGAGGGAGGAAGG + Intergenic
993879324 5:93344368-93344390 CATGCCAAGAAGAAGGGTGAAGG - Intergenic
994175872 5:96710443-96710465 AAGGGCAAGAAGAAGAGGGAAGG - Intronic
994229115 5:97293426-97293448 AAAGTCAAAAAGCAGGAGGATGG - Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994804234 5:104422531-104422553 TAGGCTAAGGAGAAAGAGGAGGG + Intergenic
994976780 5:106818379-106818401 CAGGTAAAGAAGGAGGAGGAAGG - Intergenic
995082267 5:108066070-108066092 AAAGCTAAGAAGAAGAAGGAGGG + Intronic
995321508 5:110839637-110839659 AAGGGAAAGAAGGAAGAGGAAGG - Intergenic
995418781 5:111939089-111939111 AAGACCAAGAGCAAGGGGGACGG - Intronic
995541600 5:113191264-113191286 AAACCCAAGAAGAAGAAGAAGGG - Intronic
995845521 5:116489665-116489687 AAAGCCAAGAAGAAAGGGGAAGG + Intronic
996395853 5:123013098-123013120 AAGACCCTGAAGAAGCAGGAAGG + Intronic
996501395 5:124220560-124220582 AAGAAAAAGAAGAAAGAGGAGGG - Intergenic
996656095 5:125938386-125938408 AAGGCGAAGGAGAAGGAAGAAGG - Intergenic
996847908 5:127921038-127921060 AAGGAAAGGAGGAAGGAGGAAGG + Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997097529 5:130929809-130929831 AAATCCCAGAAGAAGGAGCAGGG + Intergenic
997208945 5:132066568-132066590 AACACCAACAAGAAGGAGCAAGG + Intergenic
997625494 5:135328132-135328154 AAGGCCAAGCAGCAGGCAGAGGG - Intronic
997681096 5:135751232-135751254 CAGGCCCAGGAGAAGGAGGAGGG - Intergenic
997739906 5:136244193-136244215 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
997791442 5:136766002-136766024 AAGGGGAGGAAGCAGGAGGATGG - Intergenic
997844185 5:137271082-137271104 ATGTCCAGGATGAAGGAGGAGGG + Intronic
997853379 5:137352630-137352652 AAGACGAGGAAGAAGGAGGGAGG + Intronic
998211515 5:140202633-140202655 AAAGCCAAGAAGAAAGTTGATGG - Intronic
998715615 5:144880634-144880656 AAGGGCAAGAAGAAGTATAATGG - Intergenic
998731701 5:145084659-145084681 AGGGCCAAGAAGAAGGAATGAGG + Intergenic
998929319 5:147163144-147163166 AAGGAAGAGAAGAAGGGGGAAGG - Intergenic
999179290 5:149657549-149657571 AGGGCCAAGAAGCAGGAAGCAGG - Intergenic
999337294 5:150733034-150733056 AAGTCTGAGAAGAAGGAGGTGGG - Intronic
999384630 5:151145472-151145494 AAAGACATGAAGAAGTAGGATGG - Intronic
999592745 5:153166819-153166841 AAGGCCAATAAAAGGGGGGAGGG - Intergenic
999880069 5:155852559-155852581 ATGTCAAAGAAGTAGGAGGATGG + Intergenic
1000060524 5:157651651-157651673 AAGGCCAAGAAGCAGAAGCTGGG - Exonic
1000065518 5:157690473-157690495 AAGGCCAAGAAGTAGGAGCTAGG - Intergenic
1000242894 5:159425062-159425084 AAGGCAAACAACAAGGTGGAAGG - Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001105836 5:168853873-168853895 AAGGCCTTGATGAATGAGGAGGG - Intronic
1001305101 5:170566701-170566723 AAAGCCAAGGAGGGGGAGGATGG + Intronic
1001491219 5:172156769-172156791 CAGGCCAAGAATAAGGAGACGGG - Exonic
1001787231 5:174424339-174424361 CAGGCCCAGAAAGAGGAGGAGGG - Intergenic
1001791222 5:174459414-174459436 AAGGCAAAAAAGAAGAAAGAGGG + Intergenic
1002660440 5:180787900-180787922 AAGGCCAAGAGGCTTGAGGAGGG + Intergenic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003255434 6:4471017-4471039 AAGGGCAAGAAGAAGATGGAAGG + Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1004131216 6:12921667-12921689 AGGGAAAGGAAGAAGGAGGAAGG + Intronic
1004729017 6:18339807-18339829 AAGGCCAAGAGCAAGTAGGTTGG - Intergenic
1004869529 6:19890730-19890752 GAGGAAAAGAAGAAGGAGAAAGG - Intergenic
1004945583 6:20609260-20609282 AAGGAGGAGAAGGAGGAGGAAGG - Intronic
1005081954 6:21965396-21965418 GAGGAGGAGAAGAAGGAGGAGGG - Intergenic
1005127984 6:22470730-22470752 ATGTCCCAGAAGCAGGAGGAAGG + Intergenic
1005283901 6:24303529-24303551 AAGCGCAAGAAGAATGAGCAGGG - Intronic
1005805573 6:29471424-29471446 ATGGGCAGGAAGAGGGAGGAGGG + Intergenic
1006151411 6:31992137-31992159 AAGGCCACAAAGTAGAAGGAGGG - Exonic
1006157712 6:32024875-32024897 AAGGCCACAAAGTAGAAGGAGGG - Exonic
1006196746 6:32247846-32247868 AAGGCAAAGACAAAGGAAGATGG - Intergenic
1007073451 6:39052450-39052472 AAGGCCTCTCAGAAGGAGGAAGG - Intronic
1007198968 6:40089023-40089045 CAGAACAAGATGAAGGAGGAGGG + Intergenic
1007310781 6:40944471-40944493 AAGGCCAAGAAGCAAGTGGGGGG - Intergenic
1007514457 6:42400339-42400361 CATGCCAAGAAGGAGGAGTAAGG + Intronic
1008016429 6:46525630-46525652 AAGGAAGAGAAGAAGGGGGAGGG + Intergenic
1008075438 6:47140549-47140571 AAGGCCATGTAGAAGGAAGAAGG + Intergenic
1008397775 6:51028642-51028664 AAGGTCAAGGAAAAGAAGGATGG + Intergenic
1008915862 6:56785866-56785888 AAGATCAAGAATAAGGAAGAGGG - Intronic
1008999454 6:57696759-57696781 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1009318375 6:62253484-62253506 AAGGCCAAAGAGGAGGAGGCAGG - Intronic
1009480433 6:64151132-64151154 AAGGTCTATAAGTAGGAGGATGG + Intronic
1010161977 6:72867522-72867544 AGAGCCAACAAGAAGGAGAAGGG + Intronic
1010485669 6:76410457-76410479 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1010880082 6:81156539-81156561 CAGGCCAATAACAAGTAGGAAGG + Intergenic
1011484757 6:87830004-87830026 AAGGGAGAGGAGAAGGAGGAAGG - Intergenic
1011515646 6:88149656-88149678 AGGGACAAGGTGAAGGAGGAAGG - Intronic
1011822943 6:91273988-91274010 AAGGCCCTGAAGAAGGAACATGG + Intergenic
1011918806 6:92545728-92545750 AAGTCCCAGAAGAAGGAGTCAGG + Intergenic
1011920288 6:92566095-92566117 TAGGCCGAGGAGGAGGAGGAAGG - Intergenic
1012055068 6:94395752-94395774 AAGGAGAGGAGGAAGGAGGAGGG + Intergenic
1012143771 6:95656003-95656025 AAGGCCAAAAAGTAGGAAGAAGG + Intergenic
1012188850 6:96256028-96256050 AATGCCATGAAGAATGAGGGTGG - Intergenic
1012280437 6:97321741-97321763 AATACCAAGAAGGATGAGGAGGG - Intergenic
1012300736 6:97584767-97584789 AAAGCAAAGAAGAAAGAGAAAGG - Intergenic
1012494379 6:99818516-99818538 AAGAAGAAGAAGAAGGGGGAGGG - Intergenic
1012596006 6:101041074-101041096 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1012713184 6:102634369-102634391 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1013026094 6:106273379-106273401 AAGACCGAGAAGGAGGGGGATGG + Intronic
1013356705 6:109351546-109351568 CTGGCCAATAGGAAGGAGGAAGG + Intergenic
1013627389 6:111951420-111951442 AAGGCCAAGGAGGGGGAGAAAGG + Intergenic
1013780796 6:113726507-113726529 AAAGCCAAGAGGCAGGAAGATGG + Intergenic
1014262030 6:119230440-119230462 AAGGCCAAGAGGCTGAAGGATGG - Intronic
1014523981 6:122479044-122479066 AAGGGCAAGCAGAAGCAGGGTGG - Intronic
1014756022 6:125302290-125302312 AAGGCCAAGAAGGCGAAGGCTGG - Intergenic
1014996492 6:128152090-128152112 AAGGTCAGGAAGAAGGTAGAAGG + Intronic
1015004484 6:128262581-128262603 AAGGCAAAGAAGGAGGGAGAGGG + Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015464805 6:133536993-133537015 AAGGATAAGAAGAAGGAACATGG - Intergenic
1015666524 6:135636118-135636140 AGGGAGAAGAAGAAGGAAGAAGG - Intergenic
1015794030 6:136992966-136992988 ATGGCCATGAAGAAGGGAGAGGG + Intergenic
1016161323 6:140884000-140884022 AAGGGGAAGGAGAAGGAGAACGG - Intergenic
1016645810 6:146406876-146406898 AAGGAGAAGAAGAAGAAAGAAGG + Intronic
1017228656 6:152048467-152048489 AATGCCAAGAAGAAAAAGAATGG - Intronic
1017339591 6:153305279-153305301 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1018036924 6:159889572-159889594 AAGGCAGAAAAGAAGGAGCACGG - Intergenic
1018816789 6:167338895-167338917 AAGAAAAAGAAGAAGGAAGAGGG - Intronic
1019327620 7:446062-446084 AAGGAAAGGAAGAAGGAGGGAGG + Intergenic
1019404927 7:877960-877982 AAGGCCAGGAGGAGGGAGGCAGG - Intronic
1019465901 7:1188775-1188797 AAGAAGAAGAAGAAGGAGAAGGG + Intergenic
1019484085 7:1280526-1280548 AGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1019549245 7:1594006-1594028 GAGGGAAAGAAGAAGGAGGAGGG - Intergenic
1019757379 7:2782802-2782824 AAGGTCAGGAGGAAGGAGGATGG - Intronic
1020577346 7:9949887-9949909 AAGAAGAAGAAGAAGGAAGAGGG + Intergenic
1021014579 7:15517511-15517533 GAGGCCAAGCAGAAGCAGGGTGG + Intronic
1021289378 7:18823983-18824005 AAGAAGAAGAAGAAGGAGAAGGG + Intronic
1021481347 7:21121096-21121118 GAGGGCAAGAAGAGAGAGGAAGG - Intergenic
1021566953 7:22025620-22025642 AAGGCCAAGAGGAAGCAGCTGGG - Intergenic
1022037814 7:26550591-26550613 AGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1022317345 7:29257690-29257712 CAGGCCGAGTAGCAGGAGGAAGG - Intronic
1022574805 7:31487306-31487328 AAGGACAGGAGGAAGGAGGAAGG - Intergenic
1022898435 7:34776961-34776983 AAGGAGAAGAAGGAGAAGGAAGG - Intronic
1023013649 7:35944515-35944537 AGGACAAAGAGGAAGGAGGAGGG - Intergenic
1023028085 7:36070022-36070044 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1023296765 7:38723133-38723155 TAGGCTGAGAAGGAGGAGGAAGG + Exonic
1023521294 7:41052624-41052646 AAGGCCAATGAATAGGAGGATGG - Intergenic
1023565693 7:41521966-41521988 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1023575518 7:41622274-41622296 AAGGACAAGAAGGAGGAATAAGG + Intergenic
1023724360 7:43126928-43126950 GAGGCAAGGAAGAAGGATGAGGG - Intronic
1023883995 7:44338498-44338520 AAGGGCATGAAGAAGGAAGAGGG + Intergenic
1024077481 7:45829319-45829341 AGGACAAAGAGGAAGGAGGAGGG + Intergenic
1024464886 7:49701433-49701455 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1024525288 7:50343236-50343258 AAGGGAAAGAAAAAGGAGGAAGG - Intronic
1024721000 7:52137360-52137382 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1024963369 7:55001750-55001772 AGTGCCAGGAAGGAGGAGGAAGG - Intergenic
1025126929 7:56352088-56352110 AGGACAAAGAGGAAGGAGGAGGG - Intergenic
1025253961 7:57370527-57370549 AATGCCAAGGGGAAGGTGGATGG - Intergenic
1025607550 7:63050288-63050310 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1025828514 7:65030445-65030467 AAGAGGAAGAAGGAGGAGGAGGG + Intergenic
1025830600 7:65045888-65045910 AAGGAAAGGAAGAAGGAGGGTGG - Intergenic
1025917755 7:65879674-65879696 AAGGAAAGGAAGAAGGAGGGTGG - Intronic
1026191884 7:68136359-68136381 AAGAAGAAGAAAAAGGAGGAGGG + Intergenic
1026205680 7:68255344-68255366 AAGACGAAGAAGAGGAAGGAAGG - Intergenic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026217663 7:68364018-68364040 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
1026502387 7:70953725-70953747 AAGGCAAAGGAGAAGCAGGATGG + Intergenic
1026523336 7:71134392-71134414 AGGGGCAGGGAGAAGGAGGATGG + Intronic
1026600947 7:71776792-71776814 AAGACCAAGAAGAAAGACGCAGG - Intergenic
1026632402 7:72048781-72048803 AAGGAAAAAAGGAAGGAGGAAGG - Intronic
1027572759 7:79891458-79891480 AAGGAGGAGAAGGAGGAGGAAGG + Intergenic
1027661739 7:80996083-80996105 AATGGCAACAAGGAGGAGGATGG + Intergenic
1028246840 7:88489607-88489629 AAGAAGAAGAACAAGGAGGATGG - Intergenic
1028248258 7:88508995-88509017 AAGGCCAAGCAGGATGAGGAAGG - Intergenic
1028872710 7:95786761-95786783 GGGGCCAAGGGGAAGGAGGATGG - Intronic
1028888554 7:95961358-95961380 AAGGTAATTAAGAAGGAGGATGG + Intronic
1029363560 7:100103281-100103303 AAGGCCGAGACGTAGGAGAATGG - Intronic
1029466394 7:100727884-100727906 TAGGCCCAGCAGAAGCAGGAGGG + Intergenic
1029493429 7:100884523-100884545 AAGGATGAGAAGAAGGAAGACGG + Exonic
1029548070 7:101221830-101221852 AGGTCCAAGGAGGAGGAGGAAGG + Intronic
1030153529 7:106429050-106429072 CAGGGCAAGAAGCAGGAGTATGG - Intergenic
1030175534 7:106649690-106649712 AAGAGGAAGAAGAAGAAGGAAGG + Intergenic
1030407164 7:109129137-109129159 AAGGGCAAGAAGAAGATGGCAGG + Intergenic
1030583098 7:111384308-111384330 AGGGAAAAGGAGAAGGAGGAGGG + Intronic
1031618574 7:123908916-123908938 AAGAAGAAGAAGAAGGAAGAAGG + Intergenic
1031682881 7:124695853-124695875 AAGGGAAAGAAAAAGAAGGAAGG + Intergenic
1031838614 7:126709476-126709498 AGGAAGAAGAAGAAGGAGGAGGG + Intronic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1032159691 7:129501250-129501272 TAGACCAAGAAGCAGGAGTAGGG - Intergenic
1032246504 7:130218067-130218089 AAGGACAAGATGAAGCAGCAGGG + Intergenic
1032427480 7:131833273-131833295 GAGCCCAAGAAGAGGGTGGAGGG + Intergenic
1032526742 7:132583555-132583577 GAGGCAAAGAAGAAGAATGAAGG + Intronic
1032586567 7:133152517-133152539 AAAGCCAAGAATGAGGAAGAGGG + Intergenic
1032620783 7:133529194-133529216 AAGGCAAAGAAGAAGGAGAAAGG - Intronic
1032640369 7:133759754-133759776 AGGGAAAAGAAGAAGGAGAAAGG + Intronic
1032709724 7:134451209-134451231 AAGGACATGAGGCAGGAGGATGG - Intronic
1032751158 7:134843096-134843118 AGGCCCAAGATGAAGGAAGACGG - Intronic
1033569934 7:142617727-142617749 AAGGCAAAGAGGAAGAAAGAGGG + Intergenic
1033639495 7:143247611-143247633 AGAGAAAAGAAGAAGGAGGAAGG + Intronic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034033806 7:147798958-147798980 CAGGCAAAGAAGATGGATGATGG + Intronic
1034411704 7:150945546-150945568 GAGGCCATGGAGGAGGAGGAAGG + Intronic
1034446608 7:151117007-151117029 AAAGCAAAGAAGCAGCAGGAGGG - Intronic
1034864789 7:154631845-154631867 AAGTTCAACAAGAAGCAGGAGGG + Intronic
1034889501 7:154827613-154827635 AAGCCCAAGCAGAGTGAGGAGGG + Intronic
1035979822 8:4357765-4357787 AATGAAAAGAATAAGGAGGATGG + Intronic
1035998990 8:4580613-4580635 GATGCCACGAAGAAGAAGGAGGG - Intronic
1036273323 8:7327793-7327815 GAGGCTGAGAAGAAAGAGGAAGG + Intergenic
1036348026 8:7982559-7982581 GAGGCTGAGAAGAAAGAGGAAGG - Intergenic
1036390235 8:8318698-8318720 AAGGCCAAGCAGAAGCCGGGCGG - Exonic
1036843321 8:12143035-12143057 GAGGCTGAGAAGAAAGAGGAAGG - Intergenic
1036864685 8:12385350-12385372 GAGGCTGAGAAGAAAGAGGAAGG - Intergenic
1037277719 8:17199663-17199685 AAGAAGAAGAAGAAGGAGGGAGG - Intronic
1037468228 8:19181943-19181965 CAAGGCAAGAAGAAGAAGGATGG + Intergenic
1037514114 8:19612511-19612533 AGGCCCAAGAAAAAGGAGGAGGG + Intronic
1037568836 8:20141556-20141578 AAGGGGAAGAAGAAGCAGGGAGG + Intergenic
1037610243 8:20469966-20469988 AAGTCCAAGACCAAGGTGGAGGG + Intergenic
1037799400 8:22024334-22024356 AAGGCAACGAACAAGAAGGAGGG + Exonic
1037809037 8:22075310-22075332 AAGAAGAAGAAGAAGGGGGAGGG - Intronic
1037822734 8:22142832-22142854 GATGCCAGGAAGAAGGGGGAAGG + Intergenic
1037944966 8:22983356-22983378 AAGAAGAAGAAGAAGGAGCAAGG + Intronic
1038699603 8:29837233-29837255 GAAGCCAAGCAGAATGAGGAAGG + Intergenic
1038963682 8:32548760-32548782 AAGGGCAAGAAGAAGGAGCGAGG + Exonic
1038974721 8:32681433-32681455 AAGGTGCAGAAGAAGGAGAAGGG - Intronic
1039334871 8:36577680-36577702 AATGCCAAAAAAAAAGAGGATGG - Intergenic
1039762164 8:40589712-40589734 AAGGAAAGGAAGAAGGAAGAAGG - Intronic
1039774080 8:40718645-40718667 GAGGGAAAGAAGAAGGAGGCTGG - Intronic
1039806199 8:41001795-41001817 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1039954522 8:42196845-42196867 AAGGCAAATGAGAAGAAGGAAGG + Intronic
1040046122 8:42965447-42965469 AAGCCCAAAAGGAAGGAAGAAGG + Intronic
1040345248 8:46486043-46486065 AATCCCAAGAAGAAGGACAATGG - Intergenic
1040351472 8:46572851-46572873 AATGTCAAGAAGATGGAAGAAGG + Intergenic
1040682569 8:49831081-49831103 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1041005649 8:53494948-53494970 AAGGCCTAGAGGAGGGAGGAGGG + Intergenic
1041267603 8:56080326-56080348 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1041406243 8:57502313-57502335 AAGGCTTAGAAGAAAGAGGAAGG - Intergenic
1041567274 8:59293115-59293137 CAGGCCAAGAAGAAGGGGGAAGG + Intergenic
1041746160 8:61211358-61211380 AAGGGAAAGAAGGAGAAGGAGGG - Intronic
1042078824 8:65026800-65026822 ATAGCAAAGAAGAAGAAGGAAGG - Intergenic
1042264598 8:66895372-66895394 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1042272857 8:66973108-66973130 AAGGCAAAGAAGAGGGGGCAAGG - Intronic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1042337986 8:67648551-67648573 AAGGCCCAGAAGGAAGAGGTTGG + Intronic
1042537255 8:69871170-69871192 AAGAGCAAGAAGAAAAAGGAAGG + Intergenic
1042712241 8:71731080-71731102 AAGGCTAGGAAAAATGAGGAAGG - Intergenic
1042852748 8:73233107-73233129 AGTGGGAAGAAGAAGGAGGAAGG - Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043289582 8:78580521-78580543 AAGCCCAAGAAGTAGAAGGAGGG + Intronic
1043587162 8:81782628-81782650 TAGACCAAAAAAAAGGAGGAGGG - Intergenic
1044402224 8:91786119-91786141 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044402229 8:91786137-91786159 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044874255 8:96648768-96648790 AAGACCAAGCAGAGGGAGAAGGG + Intronic
1045015058 8:97994212-97994234 AAGGGAAAGAGGAAGGAGAAGGG + Intronic
1045015069 8:97994240-97994262 AAGGGAAAGAGGGAGGAGGAGGG + Intronic
1045047080 8:98289496-98289518 AAAAGCAAGAAGAAGGAAGAGGG - Intronic
1045682732 8:104679944-104679966 AAAGAAAAAAAGAAGGAGGAAGG - Intronic
1045975604 8:108127846-108127868 AAAACAAAAAAGAAGGAGGAAGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046327948 8:112674431-112674453 AAGGCCAAGAGTGAGGAGAATGG + Intronic
1046531985 8:115458028-115458050 AAGGCCAAAATGAGGGAGGGGGG + Intronic
1046538280 8:115544853-115544875 AAGGAGGAGAAGAAGGTGGAGGG + Intronic
1046696107 8:117341282-117341304 GAGGCTAGGAGGAAGGAGGAGGG + Intergenic
1046905209 8:119565334-119565356 AAGGACGAGAAGAAAGAGTAAGG - Intronic
1047101802 8:121684892-121684914 AAACCCCAAAAGAAGGAGGAAGG - Intergenic
1047190063 8:122670387-122670409 AAGGAAAAGAAGCAAGAGGAAGG + Intergenic
1047248814 8:123166517-123166539 AGGACCCAGAAGAAGAAGGAAGG + Intergenic
1047572264 8:126111867-126111889 ATGGGCAAGAGGGAGGAGGAAGG - Intergenic
1047603556 8:126451478-126451500 AAGGCCTAGAAGCAGGAACAGGG + Intergenic
1047830116 8:128620326-128620348 AAGGCCTAGAAACAGGAGAAAGG - Intergenic
1047966927 8:130051829-130051851 CAGGGCAAGAAGAGGGTGGAGGG - Intergenic
1048073030 8:131040936-131040958 GGGGCAAAGAAGGAGGAGGAGGG + Exonic
1048080903 8:131125430-131125452 AGGACCAAGAAGAAGGAGAGAGG - Intergenic
1048417597 8:134243792-134243814 AAGGAGGAGAAGGAGGAGGAAGG + Intergenic
1048588913 8:135802929-135802951 AAGGGCAAGAGGAAGGGGAAGGG - Intergenic
1048598716 8:135895549-135895571 CATTCCAAGTAGAAGGAGGAAGG - Intergenic
1048769904 8:137884147-137884169 AAGGAAAAGGAGAAGGAGCAGGG - Intergenic
1048865294 8:138756356-138756378 GAGGCCAAGGAGGAGGAGGCAGG - Intronic
1049009341 8:139876818-139876840 AAGGCCTAGAAGAGTGAGGTGGG - Intronic
1049252885 8:141598642-141598664 GAGGCCAAGGGGGAGGAGGAAGG - Intergenic
1049368883 8:142254079-142254101 TCTGCCAAGAAGAAGGTGGAAGG - Intronic
1049495086 8:142926317-142926339 AAGGCATAGAGGAGGGAGGACGG - Intergenic
1049566498 8:143341816-143341838 AAGAGGAAGAAGAAGGAAGAAGG - Intronic
1049759096 8:144323847-144323869 AGGGCCAAGCACAATGAGGAGGG + Intronic
1049828569 8:144685631-144685653 CGGGCCAAGAAGATGGCGGAGGG - Intergenic
1049875162 8:145012891-145012913 AAGGCCAAGAAAAAGGAACGAGG - Intergenic
1050010425 9:1180316-1180338 AAGGAGAAGAGGAAGCAGGAAGG - Intergenic
1050092721 9:2031711-2031733 GGGGCCAAGGAGAAGCAGGATGG - Intronic
1050094169 9:2047060-2047082 GAGGGCAAGAAGGAAGAGGAGGG - Intronic
1050475918 9:6040989-6041011 AAGGAAAAGAGGAAGAAGGAAGG - Intergenic
1051189256 9:14493797-14493819 AAGGAGAAGAACAAGGAGGGAGG - Intergenic
1051735335 9:20192271-20192293 AAGGCCAAGAAGATGGACAAAGG + Intergenic
1051738152 9:20224680-20224702 AAGGCAGAGAAGAAGAGGGAGGG + Intergenic
1052340609 9:27360913-27360935 AGAGCCAAGGAGAAGGTGGAGGG + Intronic
1052531180 9:29686289-29686311 AAGGAAGAGAAGGAGGAGGAGGG + Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053037827 9:34840535-34840557 AAGAAGAAGAAGAAGAAGGAAGG - Intergenic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053703725 9:40728428-40728450 AAAACCAAGAAGAATGAGGTAGG - Intergenic
1053789263 9:41674975-41674997 AAGGCAGAGGAGGAGGAGGAAGG - Intergenic
1054177545 9:61886328-61886350 AAGGCAGAGGAGGAGGAGGAAGG - Intergenic
1054413807 9:64852037-64852059 AAAACCAAGAAGAATGAGGTAGG - Intergenic
1054659986 9:67694480-67694502 AAGGCAGAGGAGGAGGAGGAAGG + Intergenic
1054747362 9:68868245-68868267 AGGATAAAGAAGAAGGAGGATGG + Intronic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055398018 9:75893378-75893400 CATGCCATGATGAAGGAGGAAGG + Intronic
1055708252 9:79031885-79031907 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1055752127 9:79518351-79518373 AAGGAAAAGAAGAAGGAAGTTGG - Intergenic
1056165547 9:83937409-83937431 GAAGGGAAGAAGAAGGAGGAGGG + Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056691327 9:88811004-88811026 AAGGCCACGTATAAGGAGGAGGG - Intergenic
1056719082 9:89058189-89058211 AAAACAAAGAAGATGGAGGATGG + Intronic
1057307889 9:93922756-93922778 AAGACAGAGAAGAAGGAAGAGGG + Intergenic
1057739767 9:97701172-97701194 GAGCCGAAGGAGAAGGAGGAGGG - Intergenic
1057906232 9:98985714-98985736 AAGTCCCTGAAGAAGGTGGATGG - Exonic
1057927303 9:99164770-99164792 AACCCCAAGAAGAATGAGAAAGG - Intergenic
1058069276 9:100585199-100585221 GAGGGAATGAAGAAGGAGGAGGG + Intronic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058618790 9:106862525-106862547 GAGGCAAAGGAGAAGGAGAAGGG - Intergenic
1059087143 9:111316423-111316445 AAAGCTTAGAAGACGGAGGAAGG + Intergenic
1059279773 9:113122634-113122656 AAGGCCAAGAAGCAATAAGATGG - Intergenic
1059354279 9:113687234-113687256 AAGGCAGAGAAGAGGGAGGAGGG + Intergenic
1059366363 9:113789539-113789561 AGAGAGAAGAAGAAGGAGGAGGG - Intergenic
1059443482 9:114323993-114324015 AAAGCCAAACAGAAGGCGGAAGG - Intronic
1059823204 9:117997116-117997138 GAGGAAAAGAGGAAGGAGGAAGG - Intergenic
1059931088 9:119261872-119261894 GAGGAAGAGAAGAAGGAGGAGGG - Intronic
1060769810 9:126324555-126324577 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1061377602 9:130235499-130235521 AAGGGCAGGACGATGGAGGAAGG - Exonic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062314580 9:135960516-135960538 AAGGGGAAGAGGAAGGAGAAGGG + Intronic
1062480954 9:136751086-136751108 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1062497923 9:136840361-136840383 AAGAGCAAGGACAAGGAGGAGGG + Exonic
1062638364 9:137503439-137503461 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638371 9:137503458-137503480 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638378 9:137503477-137503499 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638397 9:137503534-137503556 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062638457 9:137503850-137503872 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062638470 9:137504014-137504036 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1185479215 X:433677-433699 AAGGCAATGAAGAAGGAAGAAGG + Intergenic
1185523701 X:760960-760982 AAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1185862523 X:3592438-3592460 AAGGGCAAGAAGAAGAGGGAGGG + Intergenic
1186047325 X:5550482-5550504 AACAACAAGAAGGAGGAGGAGGG - Intergenic
1186058882 X:5681854-5681876 AAGGGAAAGAAAAAAGAGGAAGG + Intergenic
1186193236 X:7086642-7086664 AAGGCCTAGAAAAAGGAAGGAGG - Intronic
1186335477 X:8582472-8582494 AAGTCTAAGAGGAAGGAGAAAGG + Intronic
1186361174 X:8843661-8843683 AATGCGAAGAAAATGGAGGAAGG + Intergenic
1186539557 X:10386610-10386632 ATGGACAAGAAGAAGAAGAAGGG + Intergenic
1186908744 X:14139037-14139059 AAGGAGGAGAAGAAGGAGAAGGG + Intergenic
1187381665 X:18807478-18807500 AAGAGCAAGAAGAGGGTGGAAGG - Intronic
1187414234 X:19078750-19078772 AACCCAAAGAAGAAGAAGGAAGG + Intronic
1187709612 X:22040206-22040228 AAGGCCAAGAGGAAAGTGAAAGG - Intronic
1187843796 X:23515450-23515472 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1188568054 X:31549061-31549083 AAGGCCCATAAAAATGAGGAGGG + Intronic
1188980182 X:36720425-36720447 AAGGAGAAGAAGAAGAAGAAGGG + Intergenic
1189083082 X:37994760-37994782 GAGGAGAAGAAGGAGGAGGAAGG + Intronic
1189110794 X:38286716-38286738 AAGGGAAAGAGGAAGGAGAAGGG - Exonic
1189134263 X:38532758-38532780 AAGGCCAAGAACAAGGCCCAGGG - Intronic
1189148844 X:38684052-38684074 AAGGGCAAGAAAAAGGTCGAGGG - Intronic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189454803 X:41176260-41176282 CAGACCATGAAGGAGGAGGAGGG - Intronic
1189457904 X:41210955-41210977 AAGGAAAAGAAAAAGGAGAAAGG - Intronic
1189463457 X:41260747-41260769 AAGGCCAAGAAGATGGGGCATGG - Intergenic
1189481339 X:41394445-41394467 CAGGCACAGAAGAAGGAGGAGGG + Intergenic
1190123401 X:47682646-47682668 AAGGAAAGAAAGAAGGAGGAAGG - Intergenic
1190445627 X:50520967-50520989 ATGGCCAGGTAGAAGTAGGAAGG + Intergenic
1190734709 X:53248653-53248675 AAGGACAGCAAGAGGGAGGAAGG - Intronic
1190737723 X:53266798-53266820 AATTCCAAGAAGAAGGTGGGGGG + Intronic
1190757408 X:53412942-53412964 AAGGAGAAGAAGAAGGAGCTGGG - Exonic
1190966498 X:55305993-55306015 AAGGGCTAGAAGAAGCAGGGTGG - Intergenic
1191108379 X:56786596-56786618 AGGAGAAAGAAGAAGGAGGAGGG - Intergenic
1191779554 X:64850712-64850734 AAGGTCATGGAGGAGGAGGAGGG - Intergenic
1192050067 X:67716644-67716666 AATGCCAGGCAGAAAGAGGATGG + Intronic
1192143953 X:68668206-68668228 AAGAGAAAGAAGAAGGAGGAGGG - Intronic
1192353167 X:70373323-70373345 AAGGAAAGGAAGAAGGAAGAAGG + Intronic
1192627167 X:72741943-72741965 AAGGCCAAAAAGAAGGAAAGGGG - Intergenic
1192639091 X:72846163-72846185 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1192642620 X:72874642-72874664 GAGGAGGAGAAGAAGGAGGAGGG - Intronic
1192654541 X:72978870-72978892 AAGGCCAAAAAGAAGGAAAGGGG + Intergenic
1192765741 X:74138083-74138105 AAGGGCAAGAAGAAGACGGTAGG - Intergenic
1193103000 X:77636897-77636919 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1193228498 X:79013712-79013734 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1193361770 X:80587174-80587196 AAGGGCAAGCAGAAGTAGGGTGG - Intergenic
1194135513 X:90135768-90135790 AAGCCAAAGAAGGAGGAGAAAGG + Intergenic
1194280067 X:91940085-91940107 AAGGACAATAACAAGGGGGATGG - Intronic
1194624701 X:96214352-96214374 GAGGGCAAGATGAAGCAGGATGG + Intergenic
1194889087 X:99355303-99355325 AAGGGCAAGAAGAAGATGGTGGG - Intergenic
1195128568 X:101832462-101832484 AGGGCCAAGAAGATGGAGGCGGG - Intronic
1195682216 X:107555898-107555920 AGGGCCATGATGAAGGAGGTGGG + Intronic
1195973966 X:110505161-110505183 AAGGAAAAGGAGAAGGAGAAGGG - Intergenic
1196181102 X:112690491-112690513 GAGGAAGAGAAGAAGGAGGAGGG + Intergenic
1196329488 X:114453753-114453775 AAGAACTAGAAGAAGGAGGGAGG + Intergenic
1196762508 X:119212191-119212213 GAGGCCAAGAAAAAAGAGGTAGG + Intergenic
1197457142 X:126691115-126691137 AAGAACATGAAGAAGGAGAAGGG + Intergenic
1197583433 X:128313284-128313306 AAGGCCAAGAAAAAGAAGGTGGG + Intergenic
1197758200 X:130010713-130010735 AACCCCAACAAGAAGGGGGAGGG - Intronic
1197768010 X:130071495-130071517 AAAGCCAACAAGGAGGAGGCAGG + Intronic
1198100793 X:133419961-133419983 GAGGCCTAAAAGGAGGAGGAGGG - Intergenic
1198383379 X:136105077-136105099 AAAGGCAAGGAAAAGGAGGAAGG + Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198766971 X:140090637-140090659 AATCCCAAGATGAAGGAGCAAGG - Intergenic
1199841465 X:151653691-151653713 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
1200139007 X:153888332-153888354 AAGTCCCAGGAGAAGCAGGAGGG + Intronic
1200379716 X:155822221-155822243 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1200379724 X:155822245-155822267 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1200597540 Y:5163586-5163608 AAGGACAATAACAAGGGGGATGG - Intronic
1200791445 Y:7303254-7303276 AAGGCAGAGATGGAGGAGGAGGG + Intergenic
1200887219 Y:8281671-8281693 CTGGCCAAGAAGGAGGAGGATGG - Intergenic
1200912276 Y:8541570-8541592 AAGGCAAAGAGCAAGAAGGATGG + Intergenic
1201300261 Y:12498784-12498806 ATGACGAAGAAGTAGGAGGAAGG - Intergenic
1201356143 Y:13098927-13098949 AAGGGCAAGAAGAAGGCAGTGGG + Intergenic
1201428075 Y:13875822-13875844 AAGTCTAAGAGGAAGGAGAAAGG - Intergenic
1201557845 Y:15283252-15283274 ATGACCATGAAGAGGGAGGAAGG + Intergenic
1201726109 Y:17153808-17153830 AAGACCGAGAGAAAGGAGGAGGG + Intergenic
1201888817 Y:18919175-18919197 AAGGTGTAGAAGAAGGAAGAAGG + Intergenic
1202061703 Y:20896077-20896099 AAGGGCAAGAAGAAGATGGCAGG - Intergenic
1202336888 Y:23821221-23821243 AATACCCAGAAGAAGGATGATGG - Intergenic
1202533877 Y:25848850-25848872 AATACCCAGAAGAAGGATGATGG + Intergenic