ID: 978573458

View in Genome Browser
Species Human (GRCh38)
Location 4:110165239-110165261
Sequence AGCACATGGTTCCACTAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 72}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978573458_978573464 26 Left 978573458 4:110165239-110165261 CCTGTTTAGTGGAACCATGTGCT 0: 1
1: 0
2: 1
3: 7
4: 72
Right 978573464 4:110165288-110165310 AAGTATCGACAATTTACAGGAGG 0: 1
1: 0
2: 2
3: 5
4: 59
978573458_978573460 -8 Left 978573458 4:110165239-110165261 CCTGTTTAGTGGAACCATGTGCT 0: 1
1: 0
2: 1
3: 7
4: 72
Right 978573460 4:110165254-110165276 CATGTGCTATTGCCATTCATAGG No data
978573458_978573463 23 Left 978573458 4:110165239-110165261 CCTGTTTAGTGGAACCATGTGCT 0: 1
1: 0
2: 1
3: 7
4: 72
Right 978573463 4:110165285-110165307 GTTAAGTATCGACAATTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978573458 Original CRISPR AGCACATGGTTCCACTAAAC AGG (reversed) Intronic