ID: 978574818

View in Genome Browser
Species Human (GRCh38)
Location 4:110179130-110179152
Sequence CTGGAGGCCTAGAATTATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 1, 2: 1, 3: 9, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978574818 Original CRISPR CTGGAGGCCTAGAATTATGA AGG (reversed) Intronic
901364158 1:8731199-8731221 CTGGAGGTCCAGACTTAAGAGGG + Intronic
901597024 1:10393361-10393383 ATGGAGCACTAGAATGATGAAGG + Intergenic
909882867 1:80902231-80902253 CAGGAGGCTTAGAATTAGCAAGG + Intergenic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915347219 1:155203637-155203659 CTGGAGCCCCAGAATAAAGATGG + Intronic
915956166 1:160221798-160221820 TTTGAGACCTAGAATTAGGAAGG - Intronic
916735669 1:167605032-167605054 GTGGAGGCCTAGAGTAATGTTGG + Intergenic
918227033 1:182493439-182493461 CTGGAGGCTGAGATTTGTGAAGG + Intronic
920495676 1:206453447-206453469 CTGGAGCCATAGGACTATGAGGG + Intronic
922993494 1:229937390-229937412 GTGAATGCCTAGAATTAGGATGG - Intergenic
923746372 1:236704490-236704512 CTGGAGGCCTGGACTTGAGATGG - Intronic
924029183 1:239869296-239869318 CTTGAGCCCTAAAATGATGAAGG + Intronic
1064628308 10:17283678-17283700 CAGGAGACTTACAATTATGATGG - Intergenic
1065104240 10:22365100-22365122 CTGTAGGCATAAAATTATTAGGG + Intronic
1066277136 10:33880345-33880367 CGGGAAGCCTACAATTATGGTGG + Intergenic
1067865421 10:49900650-49900672 TTGGAGGCATAGGATAATGAGGG - Intronic
1068773834 10:60850723-60850745 CAGGAGGCCTAGAACTAAGCTGG + Intergenic
1071376176 10:85006977-85006999 ATGGAGTCCTAGAATCATGGTGG + Intergenic
1071664648 10:87542669-87542691 CAGGAGGCTTACAATCATGACGG - Intronic
1072157379 10:92736250-92736272 CTGGAGCACTAGAACTCTGAAGG - Intergenic
1079245989 11:18752695-18752717 GTGGAGGCCCAGAAGTACGAGGG + Intronic
1080886783 11:36375325-36375347 CAGAAGCCCTAGAATGATGAAGG - Intronic
1081712210 11:45224627-45224649 CTGTCGGCCTTGAATGATGAAGG - Exonic
1089193930 11:116680201-116680223 CTGGAGGCCTTGAAATATTTGGG - Intergenic
1091584243 12:1806841-1806863 CTGGAGGCCTAGAGATAAGCAGG + Intronic
1094432827 12:30388739-30388761 CAGGAAGCTTACAATTATGATGG + Intergenic
1094867216 12:34550131-34550153 ATTGAGGCCTATAATTAAGAAGG - Intergenic
1095883324 12:47162582-47162604 CAGGAAGCCTAAAATCATGATGG + Intronic
1102304967 12:111798000-111798022 CTTCAGGCTTAGAATTATGCAGG - Intronic
1102619560 12:114183128-114183150 CAGGAGGCTTAGAACTGTGAGGG - Intergenic
1104159618 12:126165657-126165679 CTGGAGGATTGGAATTAGGATGG - Intergenic
1108086923 13:46803490-46803512 CTGGAGGCCTAGACTTGCGACGG - Intergenic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1114876885 14:26731397-26731419 ATGGAGGCCTAGTCTTAGGAGGG + Intergenic
1116290284 14:43026444-43026466 CAGGAAGCCTACAATTATGATGG - Intergenic
1116737414 14:48709677-48709699 CTGGAGGGATAGAATAAGGATGG + Intergenic
1116999444 14:51357250-51357272 CTGCAGGCCTCTAATTATGTAGG - Intergenic
1118474849 14:66106914-66106936 TCGGAGGCCAAGAACTATGAAGG + Intergenic
1120969858 14:90198245-90198267 CTGGAGGCCTCCTATTATGTGGG - Intergenic
1124200616 15:27675831-27675853 CTGGAGGCCTGGACTTCTCATGG + Intergenic
1127807362 15:62533670-62533692 CAGGAGGGTTTGAATTATGATGG + Intronic
1130146956 15:81281656-81281678 ATGGAAGCCCAGGATTATGAGGG - Intronic
1133488904 16:6248222-6248244 TTGGAGGCCTAGAATTAGAATGG + Intronic
1138765128 16:59592802-59592824 CTGCAGGTCTTGAATAATGATGG - Intergenic
1144770182 17:17755357-17755379 GTGTAGGCCTAGAGTTAGGAGGG + Intronic
1148798469 17:50208925-50208947 CTGGAGGCCTGGGATTCTGGGGG + Intergenic
1153415160 18:4838308-4838330 CTGGAGGCCCAGACTTGAGATGG - Intergenic
1154937360 18:21074887-21074909 CTTGAAGAATAGAATTATGAAGG + Intronic
1154949663 18:21196815-21196837 CTGGAAGCATAGGATTGTGATGG - Intergenic
1161828099 19:6583032-6583054 CTGCAGGGCTAGATTTGTGAGGG + Intergenic
1166643353 19:44512968-44512990 CTAGAGGCACAGAATAATGAGGG - Intronic
1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG + Exonic
1167843613 19:52141686-52141708 CTGGGGACCTAGAATTGTGCAGG - Intergenic
925526192 2:4805024-4805046 ATGTAGGCCTAGGATTATAAAGG - Intergenic
926401263 2:12499560-12499582 CTGGAGAGCTGGGATTATGAAGG - Intergenic
926938264 2:18108007-18108029 CTGGAGGCATAGGTTTTTGAGGG + Intronic
930694179 2:54394521-54394543 CAGGAGACTTACAATTATGACGG + Intergenic
933145919 2:78852321-78852343 CTGGAGGCCTAGGATTGTTTGGG + Intergenic
933538128 2:83603034-83603056 CTGCGGGACTAGAATTGTGAAGG - Intergenic
938236422 2:129710004-129710026 CTGGAGGCCTGCAATCCTGATGG + Intergenic
938559159 2:132455436-132455458 CTGGAGTCATTGAATTTTGAAGG + Intronic
941925426 2:170889518-170889540 CTGGGAGCTTAGAATTATCAAGG - Intergenic
947253963 2:228140861-228140883 CTGGAAGCTTATAATCATGATGG - Intronic
948238496 2:236408773-236408795 CTGGAGGCCTTGAGGTTTGAGGG + Intronic
1169232957 20:3905026-3905048 CTGGAGCCCCAGAATCAGGATGG - Intronic
1173188208 20:40857283-40857305 CAGGAAGCTTACAATTATGACGG - Intergenic
1173537301 20:43825394-43825416 CTGTAGCCCTAGAGTTATTAGGG + Intergenic
1175955332 20:62606078-62606100 CTGGAGGCCTTGAGTTACGAGGG - Intergenic
1177641992 21:23855452-23855474 CTGGAGACCTAGCTTCATGAAGG - Intergenic
1177768824 21:25491760-25491782 CAGGAGGTCAAGAATTGTGATGG - Intergenic
1178971582 21:37182692-37182714 CTGAAAGGCTAGAATTGTGACGG - Intronic
1179302077 21:40121560-40121582 CTAGAGACATAGAAATATGATGG - Intronic
1181658289 22:24319251-24319273 CTGGAAACTTAGAATTATGGTGG + Intronic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1183123274 22:35748999-35749021 CTGTAGGCCTAGGAAAATGAGGG - Intronic
949106763 3:208797-208819 CTGGAGACCTTGAATTATACAGG + Intronic
951753827 3:26067133-26067155 CTGGCAGCCTAGATTTATCAAGG + Intergenic
953091953 3:39736800-39736822 CTGGAAACCTACAATTATGGTGG - Intergenic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
957533496 3:81471121-81471143 CTGAAGACATAGATTTATGAGGG - Intergenic
959892967 3:111577349-111577371 CTGGAGGTCAATAATTAAGAAGG - Intronic
960383507 3:116992538-116992560 CTGGAGGCCTAGAGTGCTTAGGG - Intronic
961616619 3:128187881-128187903 CAGGGAGCCTAGAAGTATGAAGG + Intronic
961724708 3:128919832-128919854 CTGGAGGCCTAGAGGTACCAGGG - Intronic
964670639 3:159221437-159221459 CTGCAGTCCTAGAATTCTGAAGG + Intronic
964966202 3:162496348-162496370 CTGGAGGCCTAGAAAGAAAATGG - Intergenic
965282382 3:166770684-166770706 CAGGAAGCTTACAATTATGACGG + Intergenic
965509773 3:169555556-169555578 CTGTAGGCCTAAAACCATGAAGG + Intronic
966629752 3:182059367-182059389 CTCGAATCCTAGAATTATAAAGG + Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
971809995 4:31412553-31412575 CTGAGGGCCTAGAATTGTGCTGG + Intergenic
972580394 4:40390503-40390525 CTGTATCCCTAGAATTTTGATGG - Intergenic
977400330 4:96523612-96523634 GTGGAGGTCTAGAATTGAGATGG - Intergenic
977447342 4:97147766-97147788 CTGAAGGCAGAGAATTCTGAAGG - Intergenic
978178879 4:105769305-105769327 CTGCAGACCTAGCCTTATGATGG - Intronic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
979741779 4:124159858-124159880 CCTGAGGGCTAGAATTTTGATGG + Intergenic
984240465 4:177212981-177213003 CAGGAGGCAAAGAATTATCAAGG + Intergenic
986881803 5:12183144-12183166 CCGGAGACCTATAATCATGATGG + Intergenic
989657493 5:43760297-43760319 CTGGTGGCATGGACTTATGAGGG + Intergenic
990631403 5:57674419-57674441 CAGGAAACTTAGAATTATGATGG + Intergenic
995341793 5:111069383-111069405 CTGGAAGCCTAGGAAAATGAAGG + Intergenic
1000973243 5:167737592-167737614 CTGGAGGTCTACAATCATGCTGG + Intronic
1005389957 6:25322980-25323002 GAGGAGGGCTAGAATTGTGATGG + Intronic
1007044157 6:38755117-38755139 CTGGTGGCCTAGTATTATGTAGG + Intronic
1008700342 6:54091745-54091767 CTGGAGGCCTAGGGTTTAGAAGG - Intronic
1008927275 6:56900131-56900153 CTGGAGTTCTAGAATGAGGATGG - Intronic
1008952498 6:57175927-57175949 CTGGAGGCCTAGACTTGCAACGG + Intronic
1009910714 6:69923667-69923689 CTGGAGTCCTACAAATATGTTGG - Intronic
1010144983 6:72658029-72658051 CTGCAGGCCAGGAAGTATGATGG + Intronic
1013851675 6:114523495-114523517 ATGGAAGCATAGAATTATGAAGG + Intergenic
1015237868 6:130991510-130991532 CTGTAGGATTAGATTTATGAGGG - Intronic
1015898089 6:138036243-138036265 CTGGAGGCCTAGGAGTATGACGG - Intergenic
1016133780 6:140512065-140512087 CTGCAGGCTGAGAAATATGAGGG - Intergenic
1019099083 6:169612797-169612819 CTGGTGGCATAAGATTATGATGG - Intronic
1022481896 7:30749707-30749729 CTGGAGGCCTTGCGTTAGGAGGG + Intronic
1022737526 7:33089957-33089979 ATGGAGGCCAAGACTTATAAGGG + Intergenic
1023370593 7:39508847-39508869 CTGGAGGGCGAGAGTTCTGAGGG - Intergenic
1023507716 7:40917989-40918011 CTGAAGGCCTAGATATAGGAGGG + Intergenic
1026197838 7:68188302-68188324 CTGGAGGCCTAAAAAGGTGAGGG + Intergenic
1030122389 7:106122744-106122766 CTGCAGGGTTAGAATTAGGAGGG - Intergenic
1031925512 7:127634623-127634645 CTTGAGGCCTAGAACTTTCAGGG - Intergenic
1032531605 7:132625288-132625310 CTGAAGGAGCAGAATTATGAAGG + Intronic
1033147787 7:138885861-138885883 CTGGAGACCTACACTTGTGATGG + Intronic
1034210919 7:149361781-149361803 CAGGAGAACTAGAATTAGGAGGG + Intergenic
1035073075 7:156158967-156158989 CTGGGGGCCTGGAAAGATGAGGG - Intergenic
1035154811 7:156903834-156903856 TTGCAGACCTAGAATTAGGATGG - Intergenic
1036621856 8:10429503-10429525 CAGGAAACTTAGAATTATGATGG + Intergenic
1038550054 8:28459692-28459714 CTGGATGCCTAGTAATAAGAGGG - Intronic
1046292351 8:112179741-112179763 CTGGAGCCTTACAATCATGATGG + Intergenic
1046494960 8:115001181-115001203 GTGAAGGCCCAGAATTATTACGG + Intergenic
1048248048 8:132830948-132830970 CTGGAGGCCGAGAGCTAAGACGG - Intronic
1052448957 9:28601470-28601492 CTGGAGGACTAGAGGTATCAGGG + Intronic
1057172090 9:92969160-92969182 CGGGTGGCCCAGAATCATGAGGG - Intronic
1058382327 9:104390716-104390738 GTGGAGGCTTAAATTTATGAAGG - Intergenic
1192931569 X:75811781-75811803 CAGGAAGCTTAAAATTATGATGG - Intergenic
1194008448 X:88527734-88527756 CTTAAGGCCAATAATTATGATGG - Intergenic
1194280079 X:91940194-91940216 CTGGAGGCTTACAATCATGGCGG - Intronic
1194558688 X:95394140-95394162 CTGGAGCCCTAGGGTTTTGATGG + Intergenic
1197571025 X:128150809-128150831 CTGGAGTCCTTGAATTTTGAAGG - Intergenic
1199239599 X:145530680-145530702 TTGGAGGCCTAGAAATCTGCAGG - Intergenic
1200597554 Y:5163695-5163717 CTGGAGGCTTACAATCATGGCGG - Intronic
1201942792 Y:19477794-19477816 CTGGAGGCCAAGAATTATGAGGG - Intergenic