ID: 978575413

View in Genome Browser
Species Human (GRCh38)
Location 4:110184985-110185007
Sequence GCCTGTGCATGTGTGTACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 423}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978575406_978575413 15 Left 978575406 4:110184947-110184969 CCCTCCACAGATCTGCTAAATCT 0: 1
1: 0
2: 2
3: 20
4: 241
Right 978575413 4:110184985-110185007 GCCTGTGCATGTGTGTACTGGGG 0: 1
1: 0
2: 4
3: 40
4: 423
978575405_978575413 16 Left 978575405 4:110184946-110184968 CCCCTCCACAGATCTGCTAAATC 0: 1
1: 1
2: 4
3: 37
4: 329
Right 978575413 4:110184985-110185007 GCCTGTGCATGTGTGTACTGGGG 0: 1
1: 0
2: 4
3: 40
4: 423
978575408_978575413 11 Left 978575408 4:110184951-110184973 CCACAGATCTGCTAAATCTGAAT 0: 1
1: 1
2: 26
3: 144
4: 902
Right 978575413 4:110184985-110185007 GCCTGTGCATGTGTGTACTGGGG 0: 1
1: 0
2: 4
3: 40
4: 423
978575407_978575413 14 Left 978575407 4:110184948-110184970 CCTCCACAGATCTGCTAAATCTG 0: 1
1: 0
2: 4
3: 57
4: 378
Right 978575413 4:110184985-110185007 GCCTGTGCATGTGTGTACTGGGG 0: 1
1: 0
2: 4
3: 40
4: 423

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978575413 Original CRISPR GCCTGTGCATGTGTGTACTG GGG Intronic
900122098 1:1053073-1053095 ACACATGCATGTGTGTACTGGGG + Intronic
900215602 1:1479961-1479983 GCCTGTGTGTGTGTGTGGTGGGG - Intronic
900285130 1:1895432-1895454 GCCTCAGCAGGTGTGTGCTGAGG - Intergenic
900581101 1:3409923-3409945 GTATGTGCATGTGTGTGGTGTGG + Intronic
900764599 1:4495396-4495418 GCCTGTGTATGTGTACACAGTGG + Intergenic
900781755 1:4623218-4623240 GACTGTGCATGTGTGTCCCTCGG - Intergenic
901474173 1:9478022-9478044 GCAGGTGCATGTATGTAGTGTGG - Intergenic
902392477 1:16114677-16114699 GCATGTGCATGTATGTAGTGGGG + Intergenic
902987565 1:20164420-20164442 GCGTGTGCATGTGTGTGTTTAGG + Intronic
904599711 1:31666697-31666719 CCCTGTGGCTGTCTGTACTGGGG - Intronic
905446794 1:38032864-38032886 GCCTCTGCATGTGTGTGCATGGG + Intergenic
905640424 1:39585828-39585850 GTGTGTGCATGTGTCTAGTGAGG + Intergenic
906520205 1:46462242-46462264 TCCTGTGAATGTTTGCACTGAGG - Intergenic
906733143 1:48100447-48100469 GTGTGTGCATGTGTGTAGTGGGG + Intergenic
906875715 1:49536376-49536398 TCATGTGCATGTGTGTGTTGGGG + Intronic
907068364 1:51510184-51510206 GCGTGTGTTTGTGTGTATTGGGG - Intronic
907244110 1:53096668-53096690 GGCGGTGTGTGTGTGTACTGAGG - Intronic
909608305 1:77528707-77528729 GCATGTAGATGTGTGTAATGAGG + Intronic
909687192 1:78363281-78363303 GGGTGTGCATGTTTGTACTTAGG - Intronic
910024128 1:82628591-82628613 GTGTGTGTGTGTGTGTACTGGGG + Intergenic
910262661 1:85307123-85307145 ACCTGTGAATGAGTGGACTGAGG + Intergenic
910846041 1:91605674-91605696 GTGTGTGTGTGTGTGTACTGGGG - Intergenic
912608639 1:111019440-111019462 GCATTTGCAGTTGTGTACTGTGG - Intergenic
914941493 1:152027128-152027150 GAGTGTGCATGTGTTTCCTGTGG + Intergenic
914995469 1:152539696-152539718 TCCTGTGCATATGAGGACTGTGG - Intronic
915003058 1:152611206-152611228 TCCTGTGCGTGTGAGAACTGTGG + Intergenic
915525702 1:156475070-156475092 ACATGTGCATGTGTGCACTTGGG - Intronic
915589779 1:156864260-156864282 GCATGTGCATGTGTATTGTGAGG + Intronic
916743943 1:167669978-167670000 GCGTGTGCGTGTGTGTCCTGAGG - Intronic
918321784 1:183371545-183371567 GGCTGTGCATGTGTGAAGGGGGG + Intronic
918407909 1:184228726-184228748 GCCTTTGAATGTGTGCACTTAGG - Intergenic
918450135 1:184649948-184649970 GCTTCCACATGTGTGTACTGAGG + Intergenic
920133020 1:203747174-203747196 GCCTGGTCATGTGTATACTTTGG - Intergenic
920353112 1:205350857-205350879 GCATGTGTGTGTGTGTGCTGAGG + Intronic
920374713 1:205501748-205501770 GCCTGTGTATGTGTGCTCTTTGG - Intergenic
921069784 1:211649436-211649458 GGGTGTGCATGTGTGTCCTTGGG + Intergenic
921343987 1:214162895-214162917 GCGTGTGCATGTGTGTATCCTGG - Intergenic
921945477 1:220883278-220883300 GTGTGTGTGTGTGTGTACTGGGG - Intronic
923678712 1:236102049-236102071 GGCTGTGCATGTGTGTTATGTGG + Intergenic
924458369 1:244236486-244236508 GACTGTGCATGTGAGTGCAGAGG - Intergenic
924547139 1:245040081-245040103 GCCTGTGAATGTTATTACTGTGG + Intronic
1062816748 10:506579-506601 CCTTCTGCATGTGAGTACTGGGG - Intronic
1062825651 10:566614-566636 GCCTGGGCTTCTGTGTGCTGGGG - Intronic
1062981151 10:1724195-1724217 GCATGTGCCTGTGTGTCCTCAGG + Intronic
1063463060 10:6226502-6226524 GTCTGTGCACGTGTGTTGTGGGG + Intronic
1064608089 10:17065137-17065159 GTCTGTGCATGTGTGTGTGGGGG - Intronic
1067061295 10:43079170-43079192 GAGTGTGCATGTGTGAGCTGTGG - Intronic
1067193000 10:44088308-44088330 GCCTGTTCATGCTTGTAATGTGG - Intergenic
1067211045 10:44260720-44260742 GCCTGTGCAGCTGGGTGCTGAGG + Intergenic
1067350772 10:45473741-45473763 GGCTGTTCATGTGAGTACTTTGG - Intronic
1067581511 10:47449527-47449549 ACCTCTGCCTGTGTGTGCTGGGG + Intergenic
1068212199 10:53934420-53934442 TTCTGTGCATGTGGGTATTGGGG - Intronic
1068788296 10:61001282-61001304 GCCTGCGGATGTGGGGACTGCGG + Intronic
1070726094 10:78791990-78792012 GCTTGTGTATGTGTTTACAGTGG - Intergenic
1071156544 10:82696063-82696085 GCCTGAGAATGTGTGCACTTAGG - Intronic
1071986124 10:91052460-91052482 GCATATGCAGGTGTGTACAGAGG + Intergenic
1072766058 10:98096093-98096115 TTCTGTGCATGTGTGGAGTGGGG + Intergenic
1072909241 10:99485204-99485226 AGCTGTGCATGTGTGGACTCTGG - Intergenic
1073124006 10:101138871-101138893 GCCTGTGTGCATGTGTACTGTGG - Intergenic
1074019677 10:109569619-109569641 GTGTGTGCATGTGTATACTTGGG + Intergenic
1074180849 10:111061488-111061510 GCCTGTGGGTGTGTCTGCTGAGG + Intergenic
1075098657 10:119490377-119490399 TCGTGTGCATGTGTGTGCGGGGG + Intergenic
1075508102 10:123043931-123043953 GTGTGTGCATGTGTGTACACAGG - Intronic
1075962425 10:126580849-126580871 GTCTGTGCATGTGTGTTTTCTGG + Intronic
1076540429 10:131211087-131211109 GCCTGTGCATCTGTGCTTTGGGG + Intronic
1076622582 10:131801735-131801757 GCTTGTGGATGTGTGGTCTGTGG - Intergenic
1076759470 10:132594619-132594641 GCCTGTGCATGGGTGGTGTGTGG + Intronic
1076903073 10:133349474-133349496 GTCTGTGCATGTGTGTTTTGTGG - Intronic
1078918586 11:15804947-15804969 GTATGTGCATGTGTGTGTTGGGG - Intergenic
1084268675 11:68017729-68017751 GGCTGTGCCTGTGTCTCCTGTGG + Intronic
1084409240 11:68996923-68996945 GCCTCTGCACGTGGGTACCGCGG + Intergenic
1086588426 11:88483109-88483131 CCCACTGCATGTATGTACTGGGG + Intergenic
1086905404 11:92412849-92412871 GGCTGTGCATGTGTGTGTAGGGG - Intronic
1087484091 11:98739260-98739282 GTGTGTGCATGTGTATATTGGGG + Intergenic
1088865009 11:113839246-113839268 GCCTGTGCCTGTGTATGCTATGG - Intronic
1088902306 11:114127488-114127510 GCATGTGTGTGTGTGTACTGGGG - Intronic
1089626194 11:119752457-119752479 GTCTGTGCATGTGTGCAGTGTGG - Intergenic
1089807939 11:121108274-121108296 GTGTGTGTATGTGTGTACTGGGG - Intronic
1089807976 11:121108555-121108577 GTGTGTGTGTGTGTGTACTGGGG - Intronic
1090399174 11:126437460-126437482 GCATATGCATGTTTGTAGTGTGG - Intronic
1090468137 11:126954006-126954028 GCCTGTGTGTGTGTGCACAGGGG + Intronic
1091116710 11:133019923-133019945 GCATGTGCATGTGTGCACTGGGG - Intronic
1091303398 11:134522056-134522078 GTCTGTGCATGTGTGTCCGTGGG - Intergenic
1091713775 12:2761535-2761557 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1092119299 12:6032751-6032773 GCATGTGCCTGTGTGTATTTGGG - Intronic
1092452207 12:8613285-8613307 GCTAGTGCCTGTCTGTACTGAGG - Intergenic
1092908992 12:13128506-13128528 GCGTGTGCATGTGCGTGCTCAGG + Intronic
1092937076 12:13374092-13374114 GTGTGTGCATGTGTGTGTTGGGG + Intronic
1093201785 12:16196406-16196428 GCCCGTGCATGTGTGCACACAGG + Intronic
1095246613 12:39930452-39930474 GAATGTGAATGTGTGTATTGTGG + Intronic
1095248906 12:39955980-39956002 GTCTGTGCATTTGTTTTCTGTGG - Intronic
1095481552 12:42641398-42641420 GGCTGTGCATGTGTGTGCTGGGG - Intergenic
1096341033 12:50799381-50799403 GCATGTGCATGTGTGTATTTGGG - Intronic
1096531228 12:52244062-52244084 GCCTGTGCAGGTGTCTGCAGTGG + Intronic
1096750635 12:53756736-53756758 GTGTGTGTGTGTGTGTACTGGGG + Intergenic
1100297256 12:93274506-93274528 GCCTGTGTATGTGAGTATTCAGG + Intergenic
1100501059 12:95174442-95174464 GCCTGAGCGTGTGTTTTCTGAGG - Intronic
1101292651 12:103387384-103387406 GTCTGTGCATGTGTGCACGAGGG - Intronic
1101726387 12:107391845-107391867 GCGTGTGTATGTGTGTGATGGGG + Intronic
1101845998 12:108363499-108363521 GCATGTGCATGTGTGTGGTATGG + Intergenic
1101875646 12:108595327-108595349 GTCTGTGCATGTGTGTATATGGG - Intronic
1102044079 12:109818795-109818817 GTGTGTGCATGTGTGTTTTGGGG - Intronic
1103907205 12:124333804-124333826 GCATGTGCCTGTGTCTACAGGGG + Intronic
1104074478 12:125377154-125377176 ACCTGTGCAGGTGGGTAGTGGGG + Intronic
1104667280 12:130656426-130656448 GCCAGTGCATTTGTGTCCTGAGG + Intronic
1105558269 13:21466138-21466160 ACCTGTGCAAATGTGTGCTGAGG - Intergenic
1106132300 13:26950658-26950680 GTGTGTGCGTGTGTGTGCTGTGG - Intergenic
1106279693 13:28254877-28254899 GACTTTGCATGTATGTCCTGTGG + Intronic
1106585679 13:31054434-31054456 GACTGTGTATGTGTGTAGGGGGG - Intergenic
1106585690 13:31054495-31054517 GACTGTGTATGTGTGTAGGGGGG - Intergenic
1106585814 13:31055389-31055411 GACTGTGTATGTGTGTAGGGGGG - Intergenic
1106778919 13:33036326-33036348 GTGTGTGCATGTGTTTAGTGAGG - Intronic
1107216628 13:37928362-37928384 ACATGTGGATGCGTGTACTGGGG + Intergenic
1107721358 13:43251947-43251969 GATTGTGCGTGTGTGTAGTGAGG + Intronic
1108537459 13:51399726-51399748 GTGTGTGCGTGTGTGTAGTGGGG + Intronic
1111463927 13:88582721-88582743 TCCTGTGCATATGTTTACTCTGG - Intergenic
1111656964 13:91166002-91166024 GACTGTGCGTGTGTGTGTTGGGG + Intergenic
1112439340 13:99414534-99414556 GGTTGTGCATGTGTGTAGAGTGG - Intergenic
1113053565 13:106241477-106241499 GGATGTGCATATGTGTAGTGGGG - Intergenic
1113671762 13:112180403-112180425 GCATATGCATGAGTCTACTGAGG + Intergenic
1113697695 13:112358310-112358332 GAATGTGCATGTGTGTTGTGGGG + Intergenic
1114346337 14:21799137-21799159 CCCTGAGCATCTCTGTACTGTGG - Intergenic
1114742283 14:25109690-25109712 GCATCTGTATTTGTGTACTGTGG + Intergenic
1116431377 14:44848985-44849007 GACTCTGCATGTGGGTTCTGTGG - Intergenic
1118509319 14:66453634-66453656 GTGTGTGCATGTGTATATTGAGG + Intergenic
1118570877 14:67194437-67194459 GCGTGTGTGTGTGTGTGCTGTGG + Intronic
1119105503 14:71919593-71919615 GCCTGCACATGTGTGTGCTGGGG + Intergenic
1119321910 14:73737138-73737160 GTCTGTGCCTGTGCGAACTGTGG - Exonic
1119524770 14:75313969-75313991 GCATGTGTATGTGTGTAACGTGG + Intergenic
1121115206 14:91338455-91338477 GCCTGAGCCTGTGTGTCCTGGGG - Intronic
1122116935 14:99532388-99532410 CTCTGTGCATGTGGGTCCTGCGG + Intronic
1124678753 15:31711008-31711030 GCATGTGCAGGTGTGTATTTCGG + Intronic
1125598623 15:40903240-40903262 GCCGCTGAGTGTGTGTACTGTGG + Exonic
1125736710 15:41932204-41932226 GCTTGTCCATGTCTGTACTTCGG - Intronic
1125888442 15:43247445-43247467 ACCTGTGCAGGTGTGTTATGTGG - Intronic
1126971764 15:54121492-54121514 GCCTGTGTGTGTGTGTTTTGTGG + Intronic
1127526399 15:59796438-59796460 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1127529547 15:59830145-59830167 GGCTGTGTATGTGTGTGCGGTGG - Intergenic
1129309627 15:74696924-74696946 GTATGTGCCTGTGTGTACAGGGG - Intergenic
1130450804 15:84049951-84049973 GGCTGTGCATGTGTGTGGGGAGG - Intergenic
1131437421 15:92434557-92434579 GCCTGTGTATGTGGCGACTGGGG + Intronic
1131527923 15:93167382-93167404 GCCTTTGCAGGTCTGCACTGAGG + Intergenic
1132678927 16:1131785-1131807 GCCTGTCCAGGTGTGCACAGGGG - Intergenic
1132930495 16:2456652-2456674 GCCAGTGCCTGTGGGTCCTGGGG - Exonic
1133770314 16:8863835-8863857 CCTTGTGTATGTGTGTATTGTGG - Intronic
1133989543 16:10694016-10694038 GCCTGAGCATGTGTGTGTTCTGG - Intronic
1134015510 16:10885321-10885343 GCATGTGTATGTGTGTAATGGGG - Intronic
1134032812 16:11006178-11006200 GCCAATGCTTGTGGGTACTGTGG + Intronic
1135031935 16:19045468-19045490 GTGTGTGCATGTGTGTGGTGGGG - Intronic
1135165403 16:20134640-20134662 GTGTGTGTATGTGTGTACAGGGG + Intergenic
1136605723 16:31332015-31332037 GTGTGTGCATGTGTGTGCTCAGG + Exonic
1136653485 16:31693741-31693763 GTGTGTGCATGTGTGTGCTGTGG - Intergenic
1137554611 16:49462759-49462781 CCCTGTGAGTGTGTGTATTGTGG - Intergenic
1138059394 16:53874212-53874234 GCTTGTGCATGTGTTAGCTGTGG + Intronic
1138311160 16:56025033-56025055 GTCTGTGGATGTGAGAACTGAGG - Intergenic
1138832416 16:60390683-60390705 GCATGTACATGTGTTTCCTGAGG - Intergenic
1139465426 16:67151419-67151441 TCCCGTGCGTGTGTTTACTGGGG - Intergenic
1139505904 16:67397992-67398014 GCCTGGGCAGGTGTGTACGTGGG + Intronic
1140627330 16:76810073-76810095 GGATGTGCATGTGTGATCTGAGG - Intergenic
1141688080 16:85581620-85581642 GCATGTGCATATGTGTGCAGGGG + Intergenic
1141860441 16:86712642-86712664 GCCGGTACATGTGTGTAAAGTGG - Intergenic
1141983423 16:87563912-87563934 GTGTGTTCATGTGTGTGCTGGGG + Intergenic
1142291108 16:89193933-89193955 GTGCGTGCCTGTGTGTACTGGGG - Intronic
1142607784 17:1091506-1091528 GCCTGGGCCTGTGTGTTATGGGG - Intronic
1142753026 17:1999677-1999699 GCCTGTGCGTGTGTGTGTGGGGG - Intronic
1143378847 17:6483320-6483342 GCCTGGGCCTGGGTGTGCTGGGG - Intronic
1143476015 17:7204404-7204426 GCGTGTGCGTGTGTGTGATGTGG - Intronic
1144321189 17:14121926-14121948 ACATGTGCATGTGTGTGGTGTGG + Intronic
1144553257 17:16260019-16260041 CCCTGAGCATGCGTGCACTGTGG - Intronic
1144798174 17:17906706-17906728 GCCTTGCCATGTGTGAACTGGGG - Intronic
1144958731 17:19032969-19032991 GTGTGCGCTTGTGTGTACTGGGG - Intronic
1147382032 17:40061970-40061992 GTGTGTGTATGTGTGTGCTGGGG + Intronic
1147875783 17:43619429-43619451 GTGTGTGCATGTGTGTATGGAGG - Intergenic
1148372435 17:47110716-47110738 GCCTGTGGGTGTGTGGAGTGAGG - Intergenic
1148679451 17:49465419-49465441 GCGTGCGCGTGTGTGTACTGAGG + Intronic
1149614583 17:57987823-57987845 GTGTGTGCGTGTGTGTGCTGGGG + Intronic
1151388493 17:73770119-73770141 CCCTGTGCCTGCGTGTGCTGGGG - Intergenic
1151436571 17:74101204-74101226 GCCTGTGCGTGTGTGTGTTCTGG - Intergenic
1151517037 17:74603201-74603223 GCCTGTGTGTGTGTGCAGTGGGG + Intergenic
1151881903 17:76900977-76900999 GTGTGTGCATGTGTGTACATGGG + Intronic
1152089428 17:78238616-78238638 GCATGTGCATGTGTGTGCTGGGG + Intronic
1152191894 17:78893203-78893225 GTGTGTGCATGTGTGTGCAGGGG + Intronic
1152223827 17:79083553-79083575 GCCTGGGCATGGGTGCACGGAGG + Exonic
1152258747 17:79255237-79255259 GTGTGTGTGTGTGTGTACTGGGG + Intronic
1152526854 17:80893216-80893238 GCCTGTGCCTGTGTGTGCGCCGG + Intronic
1152737852 17:82006077-82006099 GCGTGTGCACGTGTGTGCTTGGG + Intronic
1152859882 17:82690184-82690206 GAGTGTGCATGTGTGTCCAGGGG + Intronic
1153085293 18:1278826-1278848 GACTGTGAATGTGTGTACATTGG - Intergenic
1153327026 18:3831080-3831102 GCTGGTGCATGTGTGTAGAGGGG + Intronic
1153353178 18:4105322-4105344 TCCTGGGCATGTGTGCACGGAGG - Intronic
1153618101 18:6952437-6952459 TACTGTGCATGTGTGTGCGGGGG + Intronic
1153667745 18:7381583-7381605 GCCTGTGCATGTGTGTGCGCCGG - Intergenic
1154080252 18:11249146-11249168 GTGTGTGCATGTGTGTGCAGTGG - Intergenic
1154093637 18:11388893-11388915 GCATATGCATGTCTGTGCTGAGG + Intergenic
1154133615 18:11757575-11757597 GCATGTGGATATGAGTACTGAGG + Intronic
1154193812 18:12251805-12251827 GCCTGTGCAGCTGTGAACAGTGG - Intergenic
1154324511 18:13380207-13380229 CCTTGTGCATGTGGGTGCTGTGG + Intronic
1157421669 18:47552991-47553013 GTGTGTGCATGTGTGTATTGAGG + Intergenic
1157732054 18:50012561-50012583 GCTTGTGCATCTGTGTACCTCGG - Intronic
1159016186 18:63103330-63103352 GTGTGTGCAGGTGTGTAGTGTGG + Intergenic
1159695379 18:71551279-71551301 GCATGTGCATATGTGTACATGGG + Intergenic
1161253339 19:3293194-3293216 GCCTGTGCAGGTGTGCACGCAGG + Intronic
1161322635 19:3648449-3648471 CTCTGTGCATGGGTGTCCTGGGG + Intronic
1161967683 19:7557325-7557347 GCGTGTGCGTGTGTGTGGTGCGG - Intronic
1163325323 19:16599811-16599833 CCCTGTACAGGTGTGTCCTGTGG - Intronic
1164443329 19:28296798-28296820 GCCTGTGCATGGAGGTAGTGGGG + Intergenic
1166139349 19:40797742-40797764 GCCTGTGCATGTGTACCCCGAGG + Intronic
1166232416 19:41432746-41432768 GCGTGTGCGTGTGTGTAGGGAGG + Intronic
1166316668 19:41993339-41993361 GCGTGTGCAACTGTGTAGTGGGG - Intronic
1167181151 19:47904448-47904470 CCGCGTGCATGTGTGTACTCGGG - Intergenic
1167181819 19:47909808-47909830 CCGCGTGCATGTGTGTACTCGGG - Intergenic
1167182468 19:47915198-47915220 CCGCGTGCATGTGTGTACTCGGG - Intergenic
1167183136 19:47920550-47920572 CCGCGTGCATGTGTGTACTCGGG - Intergenic
1167183804 19:47925900-47925922 CCGCGTGCATGTGTGTACTCGGG - Intergenic
1167184433 19:47930950-47930972 CCGCGTGCATGTGTGTACTCGGG - Intergenic
1167185105 19:47936301-47936323 CCGCGTGCATGTGTGTACTCGGG - Intergenic
1167185758 19:47941690-47941712 CCGCGTGCATGTGTGTACTCGGG - Intergenic
1167186425 19:47947045-47947067 CCGCGTGCATGTGTGTACTCGGG - Intergenic
1167187076 19:47952436-47952458 CCGCGTGCATGTGTGTACTCGGG - Intergenic
1167542116 19:50095813-50095835 CCGCGTGCATGTGTGTACTCGGG + Intergenic
1167542550 19:50098878-50098900 CCGCGTGCATGTGTGTACTCGGG + Intergenic
1167542987 19:50101943-50101965 CCGCGTGCATGTGTGTACTCGGG + Intergenic
1167543423 19:50105006-50105028 CCGCGTGCATGTGTGTACTCGGG + Intergenic
1167544096 19:50110350-50110372 CCGCGTGCATGTGTGTACTCGGG + Intergenic
1167544771 19:50115703-50115725 CCGCGTGCATGTGTGTACTCGGG + Intergenic
1167545446 19:50121055-50121077 CCGCGTGCATGTGTGTACTCGGG + Intergenic
1167546123 19:50126410-50126432 CCGCGTGCATGTGTGTACTCGGG + Intergenic
1167546800 19:50131745-50131767 CCGCGTGCATGTGTGTACTCGGG + Intergenic
1167547457 19:50137118-50137140 CCGCGTGCATGTGTGTACTCGGG + Intergenic
1167767243 19:51491684-51491706 TCCTGTTCCTGTGGGTACTGAGG + Exonic
1168018783 19:53594305-53594327 GGCTGTGCAGGTGTGTGTTGTGG + Intergenic
925237235 2:2290621-2290643 GTGTGTGTATGTGTGGACTGGGG - Intronic
925641259 2:5987933-5987955 GGTTGTGCGTGTGTGCACTGGGG - Intergenic
925641273 2:5988045-5988067 GGTTGTGCGTGTGTGCACTGGGG - Intergenic
925641280 2:5988102-5988124 GGTTGTGCGTGTGTGCACTGGGG - Intergenic
928161502 2:28930549-28930571 GTTTGTGAATGTGTGTATTGTGG + Intronic
928410475 2:31050372-31050394 GCCTGTCCATCTGTGTTCAGAGG - Intronic
930269547 2:49240223-49240245 GTTTGTGTGTGTGTGTACTGGGG + Intergenic
931241290 2:60454574-60454596 TCATGTTCATGTGTGTACGGAGG + Intronic
932188497 2:69718644-69718666 GTGTATGCATGTGTGTGCTGTGG - Intronic
932304417 2:70691806-70691828 CCCTGTACATGTGTGGCCTGGGG + Intronic
934537613 2:95148709-95148731 ACCTGTGAATGTGGGTAATGTGG - Exonic
934948294 2:98558034-98558056 GAATTTGCATGTGTGTACAGAGG + Intronic
935070381 2:99688779-99688801 GCCTGGGCATCTCTGCACTGTGG + Intronic
935195146 2:100809345-100809367 CCCTGTGGATGTCTGTGCTGTGG - Intergenic
937663565 2:124459211-124459233 GCCTGTGGCTGAGTGTACTCTGG - Intronic
937787485 2:125919420-125919442 ACCTGTGCATGTGTATAATACGG - Intergenic
939194289 2:138953588-138953610 TTGTGTGCATGTGTGTAATGTGG + Intergenic
940627699 2:156196198-156196220 GCCTGTGTATGTGTGTATGAAGG + Intergenic
941037510 2:160584356-160584378 GTCTGTGCAGGAGTGAACTGGGG + Intergenic
942374065 2:175317941-175317963 GCATGTGCATGTGTGTGCTGAGG + Intergenic
942780567 2:179636804-179636826 GCTTCTGTGTGTGTGTACTGAGG - Intronic
944436554 2:199696144-199696166 GCATGTGCATGTGTGTGCCCTGG - Intergenic
944739925 2:202601889-202601911 GTCTGTGCGTGTGTGTGCTGGGG - Intergenic
946346542 2:219115656-219115678 ACTTGTGCATGTGTATACAGTGG - Intronic
947000693 2:225452780-225452802 ACGTGTGCATGTGTGTGGTGGGG - Intronic
947077383 2:226360097-226360119 GTGTGTGTATGTGTGTATTGGGG - Intergenic
947099019 2:226598979-226599001 GCATGTGCATGTGTGTGTAGAGG + Intergenic
947386623 2:229596974-229596996 GCGTGTGCATGTGTGTGCGCAGG - Intronic
947548969 2:231032968-231032990 GCCAGTACAGGTGTGTCCTGGGG + Intergenic
948304739 2:236938265-236938287 GTGTGTGCATGTGTGTGGTGTGG + Intergenic
948385701 2:237579281-237579303 GACAGTGCATGAGTGTCCTGCGG + Intronic
948594477 2:239070709-239070731 GCCTGTGCAGGTGAGGACGGTGG + Intronic
1170008211 20:11692178-11692200 GGTTGTGCATGTGTGTACAGGGG + Intergenic
1170926702 20:20731238-20731260 CCCTCTGCATATGTGTCCTGGGG - Intergenic
1172619972 20:36312324-36312346 GCGTGTGCATGTGCATATTGAGG - Intronic
1173050807 20:39559604-39559626 GCCTGTGCAGCTTTGTAGTGGGG + Intergenic
1173447863 20:43136601-43136623 TACTGTGCATGTGTGTAGTATGG - Intronic
1174132160 20:48352830-48352852 GCCAGGGTATGGGTGTACTGGGG - Intergenic
1175485267 20:59341592-59341614 GTGTGTGCATGTGTGTATGGGGG + Intergenic
1175720470 20:61283568-61283590 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175720471 20:61283607-61283629 GCATTTGCACGTGTGTGCTGTGG + Intronic
1177012280 21:15743833-15743855 GCCTGGGAATTTGTCTACTGTGG + Intronic
1178687048 21:34720182-34720204 GCCTGTGGTGGTGGGTACTGGGG - Intergenic
1179153926 21:38833076-38833098 GTGTGTGCATGTGTGTTCTTGGG - Intergenic
1180195774 21:46192744-46192766 GCATCTGCATGTGTGTACACAGG + Intronic
1180195792 21:46192978-46193000 GCATCTGCATGTGTGTACACAGG + Intronic
1180195801 21:46193095-46193117 GCATCTGCATGTGTGTACACAGG + Intronic
1181882687 22:25993437-25993459 GCCTGCTCAGGTGTGTACAGGGG - Intronic
1182025946 22:27119403-27119425 GGCTCTGCATGCCTGTACTGAGG - Intergenic
1182346613 22:29670899-29670921 GGCTGTGCAAGTCTGTGCTGTGG + Intronic
1183233023 22:36594876-36594898 GTCTGTGCCTGTGTGTACATGGG + Intronic
1183343673 22:37295363-37295385 GTGTGTGCATGTGTGTGGTGGGG - Intronic
1183359931 22:37378195-37378217 GCATGTGCTTGTGTGTGCAGGGG + Intronic
1184400177 22:44269090-44269112 TGCTGTGCGTGTGTGTATTGTGG - Intronic
1184924645 22:47628611-47628633 GTGTGTGCATGTGTGCATTGTGG + Intergenic
1184924686 22:47629105-47629127 GCATGTGCATGTGTGTGATGTGG + Intergenic
1184934209 22:47707161-47707183 GCATGTGCATGTGTGTCCGATGG + Intergenic
1185065904 22:48631576-48631598 GGCTGTGCATCTGGGTAATGAGG - Intronic
950459615 3:13113402-13113424 GCCTGTGCATCTGTGAAGTGGGG + Intergenic
951145576 3:19222498-19222520 GCATGTGCATTTGTATACAGAGG + Intronic
953276548 3:41506254-41506276 GTTTATGCCTGTGTGTACTGGGG - Intronic
953743181 3:45554348-45554370 ACGTGTGCATGTGTGTGGTGTGG - Intergenic
954553353 3:51499919-51499941 GGCTGTGTGTGTGTGAACTGTGG - Exonic
954952789 3:54490018-54490040 CCCGGTGCATGTGTGTCCTATGG - Intronic
954984874 3:54781216-54781238 CTCTGTGAATGTATGTACTGTGG - Intronic
955135000 3:56208714-56208736 GCCTTTGCCTGTGTCTAATGAGG - Intronic
955534378 3:59907605-59907627 GTGTGTGCATGTGTGCACTGGGG + Intronic
956230210 3:67006186-67006208 GTCTGTGTATGTGTGTATTTTGG + Intronic
956369196 3:68539704-68539726 GTGTGTGCATGTGTGTGGTGGGG + Intronic
957347731 3:78983315-78983337 GCCTGTAGATGTGTGTATAGGGG - Intronic
960015914 3:112887685-112887707 GGCTGTGCATGTGTGTGGGGAGG - Intergenic
961043587 3:123694025-123694047 GGCTGTGCATTTGTGTAATGGGG - Intronic
961109567 3:124272582-124272604 GCATGTGCATGTGAGTAGAGGGG + Intronic
961519389 3:127457919-127457941 GCACGTGCATGTGTGTGTTGGGG - Intergenic
961868350 3:129970901-129970923 GTGTGTGTATGTGTGTATTGTGG + Intergenic
962190081 3:133300969-133300991 GTGTGTGTGTGTGTGTACTGGGG - Intronic
962202073 3:133409242-133409264 GTGTGTGTGTGTGTGTACTGTGG + Intronic
962710406 3:138081261-138081283 GCGTGTGTCTGTGTGTAATGGGG - Intronic
963303975 3:143629587-143629609 GTGTGTGTATGTGTGTAGTGGGG + Intronic
963334712 3:143961342-143961364 GCGTGTGTATGTGTGTAGAGGGG + Intergenic
963770764 3:149384042-149384064 GCCTCTGCATCTCTTTACTGTGG - Intergenic
964619913 3:158710973-158710995 GTGTGTGCTTGTGTGCACTGGGG - Intronic
965545689 3:169914184-169914206 AGCTGTGCATGTGTGTGTTGGGG + Intronic
965795957 3:172438852-172438874 GCCTGTGGGTGTGTGGAGTGGGG - Intergenic
966857125 3:184202430-184202452 GTGTGTGCATGTGTGTGCAGTGG - Intronic
968446442 4:654607-654629 GCCTGTGCATGTGTGGACATGGG + Intronic
968637754 4:1690803-1690825 GTGTGTGCATGTGTGTGGTGGGG - Intergenic
969323268 4:6425918-6425940 GCATGTGCATGTGTGTTGCGGGG + Intronic
969613451 4:8239389-8239411 GCATGTGCCTGTGTGTACATGGG - Intronic
969686655 4:8679139-8679161 GCTTGTGCTTTTGTGTCCTGTGG + Intergenic
972729445 4:41779195-41779217 GCGTGTGTGTGTGTGTAATGTGG - Intergenic
973947837 4:55978022-55978044 GCATGTGCATGTGTGTGTTTAGG + Intronic
974799200 4:66793753-66793775 GCCTGTGGATGTGAGTATTCAGG - Intergenic
975601784 4:76107943-76107965 GTGTGTGCATGTGTGTGTTGGGG + Intronic
976108640 4:81646360-81646382 GTGTGTGTGTGTGTGTACTGGGG + Intronic
977151209 4:93514416-93514438 GTGTGTGTGTGTGTGTACTGTGG - Intronic
978575413 4:110184985-110185007 GCCTGTGCATGTGTGTACTGGGG + Intronic
979673104 4:123382232-123382254 GTCTGTGCCTGTGTGCACTTGGG - Intergenic
979882578 4:125980260-125980282 GCATGTGCATGTGTGTGGGGAGG + Intergenic
980997975 4:139799458-139799480 TACTGTGCATGTGTGTATTAAGG + Intronic
981419691 4:144534941-144534963 GTGTGTGTGTGTGTGTACTGGGG + Intergenic
981424484 4:144587577-144587599 GTGTGTGTGTGTGTGTACTGGGG + Intergenic
981693854 4:147539453-147539475 GCCTGTGTGTGTGTGTAGTGGGG - Intronic
981968299 4:150633739-150633761 GTGAGTGGATGTGTGTACTGTGG - Intronic
983723369 4:170887066-170887088 TCCTGTGCTGGTGTGTTCTGTGG - Intergenic
983879638 4:172918539-172918561 GTCTGTGAATGTGTGTGTTGGGG - Intronic
984198652 4:176691463-176691485 GCCTGTGTGTGTGTGTGGTGGGG - Intronic
984582868 4:181530809-181530831 GCATGTGCATGTATGTACGTGGG + Intergenic
985795728 5:1960717-1960739 GTGTGTGCATGTGTGTTTTGGGG - Intergenic
985959448 5:3288957-3288979 GTGTGTGCGTGTATGTACTGAGG - Intergenic
985982627 5:3484421-3484443 GTGTGTGCATATGTGTAGTGTGG - Intergenic
986026982 5:3859932-3859954 GCCAGTGCATGAGTGTCCTGTGG + Intergenic
986199709 5:5569967-5569989 GCCTGTGCTTGTGGGCCCTGGGG + Intergenic
986469211 5:8057778-8057800 GACTGTGTATGTGTGTTCTGGGG - Intergenic
986518115 5:8584259-8584281 GCGTGTGTGTGTGTGTAATGAGG - Intergenic
989460080 5:41687154-41687176 GACTGTGCATGTGTGGAGGGAGG + Intergenic
990562634 5:56998027-56998049 GTGTGTACATGTGTGTATTGGGG - Intergenic
991025060 5:62020207-62020229 GCCTGAGCTTTTGTGTAGTGTGG - Intergenic
991069305 5:62458681-62458703 GCCTGTGCATGTGTGTGTCTAGG + Intronic
991449168 5:66733315-66733337 CTCTGTGCATGTGTGTGGTGGGG - Intronic
991471316 5:66971748-66971770 GCATGTGTATGTGTGTGTTGGGG + Intronic
993276008 5:85859779-85859801 GCATATGCATGTGTGTACGTAGG + Intergenic
993321158 5:86468879-86468901 GCATGTACATATGTGTACTTAGG + Intergenic
994312215 5:98286706-98286728 GTGTGTGTGTGTGTGTACTGTGG - Intergenic
994967855 5:106697191-106697213 CTCTGTGTATGTGTGTATTGTGG + Intergenic
995602940 5:113818237-113818259 GCATGTGCATGTGTGTATGCAGG + Intergenic
997232034 5:132252476-132252498 GTCTGTGGATGTGTGCGCTGGGG + Intronic
997259735 5:132456736-132456758 GCCTGTGCCTGTGTGGCCTCTGG - Intronic
999270984 5:150296281-150296303 GTGTGTGCATGTGTGTCCTGGGG - Intergenic
1000478049 5:161736322-161736344 GGCTGTGCATGTATGGACGGAGG + Intergenic
1001324905 5:170716048-170716070 TCCTGTGAATGTGTCTACAGCGG + Intronic
1001347449 5:170918397-170918419 GTGTGTGTGTGTGTGTACTGTGG - Intronic
1002254995 5:177952049-177952071 GTCTGTGCGTGTGTGTGCTGGGG + Intergenic
1002982206 6:2149418-2149440 GCCTGTTCATGGGAGTTCTGTGG - Intronic
1003820908 6:9895939-9895961 GGCTGTGGATGTGTGTGTTGGGG - Intronic
1004324679 6:14664359-14664381 GCCTGTGCAGGTGGCTGCTGAGG + Intergenic
1006520267 6:34567254-34567276 GTGTGTGTATGTGTGTTCTGAGG - Intergenic
1006643452 6:35500231-35500253 GCCTGGGCATGTGTGCACAGGGG + Intronic
1006646870 6:35520992-35521014 GCCTGGGCATGTGTGAGCAGAGG - Intergenic
1006907407 6:37542130-37542152 GGGTGTGCCTGTGTGTATTGTGG + Intergenic
1007168648 6:39847023-39847045 GACTGTGCCTGTGGGTCCTGAGG + Intronic
1007380411 6:41486828-41486850 GCAAGTGCATGTGTGTGCTGGGG + Intergenic
1009045840 6:58237053-58237075 GCATTTGCAGGTGTGTTCTGTGG + Intergenic
1009221655 6:60991366-60991388 GCATTTGCAGGTGTGTTCTGTGG + Intergenic
1009758226 6:67968840-67968862 GCTTGTGAATGTGTGTTCTGTGG - Intergenic
1011172763 6:84524307-84524329 GCATGTGCACGTGTGTGATGGGG + Intergenic
1011882369 6:92045745-92045767 GCCTGGGCATGGCTGGACTGGGG + Intergenic
1013000000 6:106012509-106012531 GTGTGTGCATGTGTGTAGTATGG - Intergenic
1013034982 6:106373008-106373030 GGCTGTGTGTGTGTGTACAGGGG + Intergenic
1015337611 6:132058525-132058547 GTGTGTGCATGTGTGTAGTAAGG + Intergenic
1015507371 6:134003105-134003127 GACTGAGCACTTGTGTACTGAGG + Intronic
1015795297 6:137005310-137005332 GCCTGGGGATGTGTGTAGGGAGG + Intronic
1016942317 6:149492983-149493005 GCCTGTGCCTGCCTGTGCTGGGG + Intergenic
1017461689 6:154656808-154656830 GCCTGTGCCTGTGGGGAATGAGG - Intergenic
1017645626 6:156537418-156537440 TCCTGAACATGTGTATACTGAGG - Intergenic
1017732813 6:157332928-157332950 GCGTGTGCAGGTGTGCAATGAGG - Intergenic
1018244104 6:161805437-161805459 GTGTGTGCATGTGTGTACTCAGG - Intronic
1018380818 6:163256604-163256626 GCCTTTGCATGTGCTTTCTGTGG - Intronic
1018706864 6:166469806-166469828 GCGTGTGCAGGTGGGGACTGTGG + Intronic
1019025484 6:168959156-168959178 ACCGGTGTATGTGTGTAATGGGG + Intergenic
1019135840 6:169907150-169907172 GCATGTGCCTGTGTGTACAGGGG - Intergenic
1021778190 7:24074234-24074256 CCCTGTGCATGTCTGTCCCGAGG - Intergenic
1021840100 7:24715344-24715366 CCCTCTGCATGTGTGTGGTGAGG - Intronic
1021955911 7:25824205-25824227 GGCTGTGTATATGTGTATTGAGG - Intergenic
1022234474 7:28447635-28447657 GTGTGTGTATGTGTGTATTGTGG + Intronic
1022311668 7:29202178-29202200 AACTGTGAATGTGTGGACTGAGG + Intronic
1023629390 7:42148658-42148680 CCCTGTGTATTTGTGTACTTTGG - Intronic
1026788194 7:73314926-73314948 GCCTGTGCCTGTGTGTAAAGTGG + Intronic
1027266567 7:76498087-76498109 GGCTGTGGAAGTGTGGACTGTGG + Intronic
1027317948 7:76996205-76996227 GGCTGTGGAAGTGTGGACTGTGG + Intergenic
1027350807 7:77309229-77309251 GCCTGGGTATGTGTCTGCTGAGG + Intronic
1028950131 7:96625160-96625182 GCCTGCTCAGGTGAGTACTGTGG + Intronic
1029043614 7:97603659-97603681 GTGTGTGCATGTGTGTATTGTGG + Intergenic
1029913017 7:104174895-104174917 GGCTGTCCATGTGTGTGCAGTGG - Intronic
1031343324 7:120633016-120633038 GCCTGTAAATGTGTTAACTGTGG - Intronic
1032807903 7:135375952-135375974 GTGTGTGTATGTGTGTACAGGGG + Intronic
1033822785 7:145153974-145153996 GTGTGTGTATGTGTGTAGTGGGG + Intergenic
1034521481 7:151623896-151623918 CAATGCGCATGTGTGTACTGGGG + Intronic
1034869547 7:154671849-154671871 GTGTGTGCATGTGTGTGTTGGGG - Intronic
1035727549 8:1834128-1834150 GCCTGGGCAAGTGGATACTGTGG + Intronic
1035853348 8:2944335-2944357 GTGTGTGTATGTGTGCACTGAGG + Intronic
1035877397 8:3206348-3206370 GTGTGTGTATGTGTGTATTGGGG + Intronic
1036201532 8:6774715-6774737 GCGTGTGCACCTGTGTGCTGAGG - Intergenic
1036415923 8:8548531-8548553 GGCTGTTCATGTCTGTGCTGTGG + Intergenic
1036580961 8:10075421-10075443 GACTGTGTATGTGTGTCCAGTGG + Intronic
1037411313 8:18600968-18600990 ACCTGTGCATATCTCTACTGAGG + Intronic
1039321308 8:36435018-36435040 GTCTGTGCATGTGTTTCCAGAGG + Intergenic
1039389710 8:37168283-37168305 GCCTGAGCATGAGTTTCCTGAGG + Intergenic
1039778153 8:40757349-40757371 GTGTGTGTATGTGTGTACAGTGG - Intronic
1040486933 8:47882391-47882413 GCTTGTGCATGCATGTACAGTGG - Intronic
1040486939 8:47882484-47882506 GCTTGTGCATGCATGTACAGTGG - Intronic
1041312313 8:56529555-56529577 GCCTGTGCTTCTGCCTACTGGGG - Intergenic
1044212247 8:89563323-89563345 GCAGGTGCATGTGTGTGATGGGG - Intergenic
1045375080 8:101564423-101564445 GCACGTGCATGTGTGCACAGTGG + Intronic
1046381666 8:113458980-113459002 GTGTGTGTATGTGTGCACTGAGG - Intergenic
1047203706 8:122786725-122786747 ATGAGTGCATGTGTGTACTGGGG - Intronic
1047802320 8:128322921-128322943 GCCTGAGCTTGTGTTCACTGTGG + Intergenic
1048254127 8:132892655-132892677 GTGTGTGTATGTGTGTGCTGTGG + Intronic
1049321409 8:141998841-141998863 GCCCGTGCATGAGTGGCCTGTGG + Intergenic
1050176873 9:2877352-2877374 GACTGTGCATGTATGTATGGAGG + Intergenic
1050971503 9:11882295-11882317 CCCTGTGCATGTGTGGTCAGTGG - Intergenic
1052337135 9:27331470-27331492 GTGTGTGTGTGTGTGTACTGGGG + Intronic
1052611326 9:30778131-30778153 GTGTGTGTATGTGTGTACAGAGG + Intergenic
1052861698 9:33441724-33441746 GTGTGTGCATGTGTGTGCAGGGG - Exonic
1053410685 9:37914470-37914492 GCACGTGCATGTGTATGCTGGGG + Intronic
1053507378 9:38654795-38654817 GGCTGTGCTTGTGTCTTCTGGGG + Intergenic
1055009796 9:71552860-71552882 GCCAGTGCCTGTGTCAACTGTGG + Intergenic
1055196277 9:73598415-73598437 GCATGTGTATGTGTCTATTGGGG - Intergenic
1055589278 9:77793696-77793718 GCATGTGTATGTGTGTGTTGGGG - Intronic
1056591601 9:87969569-87969591 CACTGCACATGTGTGTACTGGGG + Intronic
1057741349 9:97714662-97714684 GGGTGTGCATTTGTGTATTGGGG + Intergenic
1058058928 9:100474706-100474728 GCCTGTGTGTGTGTGTTTTGCGG + Intronic
1060721709 9:125983963-125983985 GCATGTCCCTGTGTGCACTGTGG + Intergenic
1060826876 9:126692862-126692884 TCCTGTGCAGGTGTGCCCTGCGG + Intronic
1060887978 9:127168919-127168941 GCGTGTGCTTGTGTGTGCTGGGG - Intronic
1061150291 9:128824294-128824316 GTGTGTGCGTGTGTGTACTAAGG + Intronic
1061307515 9:129740595-129740617 GCATGTGCATATGTGTGGTGGGG + Intronic
1061805437 9:133135213-133135235 GCCTTGGCAGGTGTGTCCTGTGG - Intronic
1062265869 9:135686201-135686223 GCCTCTGCTTGTGTGCACTGTGG - Intergenic
1185518452 X:718520-718542 GGCTGTGCATGTGTGTGAGGTGG + Intergenic
1185567992 X:1110848-1110870 GCGTGTGCATGTGTGTATGTAGG + Intergenic
1186037562 X:5441281-5441303 GGCTGTGCATGTGTGTGGGGAGG + Intergenic
1186404779 X:9292384-9292406 GCATGTGCATGTGTGTATATGGG - Intergenic
1187231640 X:17429200-17429222 GCATCTGCCTGTGTGTACTGGGG + Intronic
1188214071 X:27456799-27456821 CTCTGTCTATGTGTGTACTGGGG + Intergenic
1191690065 X:63930305-63930327 CCCAGTCCATGTGTGGACTGGGG + Intergenic
1191860754 X:65665105-65665127 CCCTGTGTATGTGTGTTGTGGGG + Intronic
1192036438 X:67567904-67567926 GCCTGTGCATGTGTGGTGTAAGG + Intronic
1194379833 X:93178295-93178317 ACCTGTGCAGGTGTTAACTGTGG - Intergenic
1194426381 X:93743629-93743651 GCATGTGCATGTGTGTATATTGG + Intergenic
1195152056 X:102082139-102082161 GGCTGTGCATGTGGGTTGTGTGG - Intergenic
1195716591 X:107824974-107824996 GCGTGTGTGTGTGTGTGCTGGGG + Intergenic
1195745654 X:108115137-108115159 GTGTGTGTGTGTGTGTACTGAGG + Intronic
1196611781 X:117723434-117723456 CCATGTGCATGTGTGTATTGTGG + Intergenic
1197653197 X:129087233-129087255 GCCTGGGTATGTGTCTGCTGGGG - Intergenic
1198996087 X:142576367-142576389 GTCTGGGCTTGTTTGTACTGAGG + Intergenic
1201728247 Y:17178696-17178718 GTGTGTGCCTGTGTGTATTGGGG - Intergenic