ID: 978578722

View in Genome Browser
Species Human (GRCh38)
Location 4:110211771-110211793
Sequence GTTGGAAAAGGCAGCCCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978578722_978578732 27 Left 978578722 4:110211771-110211793 CCCAGTGGGCTGCCTTTTCCAAC No data
Right 978578732 4:110211821-110211843 ATCAGAGAGAGACCATGACTGGG No data
978578722_978578731 26 Left 978578722 4:110211771-110211793 CCCAGTGGGCTGCCTTTTCCAAC No data
Right 978578731 4:110211820-110211842 CATCAGAGAGAGACCATGACTGG No data
978578722_978578733 28 Left 978578722 4:110211771-110211793 CCCAGTGGGCTGCCTTTTCCAAC No data
Right 978578733 4:110211822-110211844 TCAGAGAGAGACCATGACTGGGG No data
978578722_978578727 3 Left 978578722 4:110211771-110211793 CCCAGTGGGCTGCCTTTTCCAAC No data
Right 978578727 4:110211797-110211819 GATCCAGCCTTCACCATCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978578722 Original CRISPR GTTGGAAAAGGCAGCCCACT GGG (reversed) Intergenic
No off target data available for this crispr