ID: 978578724

View in Genome Browser
Species Human (GRCh38)
Location 4:110211783-110211805
Sequence GGCTGGATCACGGTTGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978578724_978578731 14 Left 978578724 4:110211783-110211805 CCTTTTCCAACCGTGATCCAGCC No data
Right 978578731 4:110211820-110211842 CATCAGAGAGAGACCATGACTGG No data
978578724_978578733 16 Left 978578724 4:110211783-110211805 CCTTTTCCAACCGTGATCCAGCC No data
Right 978578733 4:110211822-110211844 TCAGAGAGAGACCATGACTGGGG No data
978578724_978578732 15 Left 978578724 4:110211783-110211805 CCTTTTCCAACCGTGATCCAGCC No data
Right 978578732 4:110211821-110211843 ATCAGAGAGAGACCATGACTGGG No data
978578724_978578727 -9 Left 978578724 4:110211783-110211805 CCTTTTCCAACCGTGATCCAGCC No data
Right 978578727 4:110211797-110211819 GATCCAGCCTTCACCATCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978578724 Original CRISPR GGCTGGATCACGGTTGGAAA AGG (reversed) Intergenic
No off target data available for this crispr