ID: 978578725

View in Genome Browser
Species Human (GRCh38)
Location 4:110211789-110211811
Sequence GGTGAAGGCTGGATCACGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978578725_978578731 8 Left 978578725 4:110211789-110211811 CCAACCGTGATCCAGCCTTCACC No data
Right 978578731 4:110211820-110211842 CATCAGAGAGAGACCATGACTGG No data
978578725_978578733 10 Left 978578725 4:110211789-110211811 CCAACCGTGATCCAGCCTTCACC No data
Right 978578733 4:110211822-110211844 TCAGAGAGAGACCATGACTGGGG No data
978578725_978578732 9 Left 978578725 4:110211789-110211811 CCAACCGTGATCCAGCCTTCACC No data
Right 978578732 4:110211821-110211843 ATCAGAGAGAGACCATGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978578725 Original CRISPR GGTGAAGGCTGGATCACGGT TGG (reversed) Intergenic
No off target data available for this crispr