ID: 978578729

View in Genome Browser
Species Human (GRCh38)
Location 4:110211804-110211826
Sequence TCTGATGCCTCTGATGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978578729_978578735 30 Left 978578729 4:110211804-110211826 CCTTCACCATCAGAGGCATCAGA No data
Right 978578735 4:110211857-110211879 AGAGAGTTGACTGTTGTGTAAGG No data
978578729_978578732 -6 Left 978578729 4:110211804-110211826 CCTTCACCATCAGAGGCATCAGA No data
Right 978578732 4:110211821-110211843 ATCAGAGAGAGACCATGACTGGG No data
978578729_978578733 -5 Left 978578729 4:110211804-110211826 CCTTCACCATCAGAGGCATCAGA No data
Right 978578733 4:110211822-110211844 TCAGAGAGAGACCATGACTGGGG No data
978578729_978578731 -7 Left 978578729 4:110211804-110211826 CCTTCACCATCAGAGGCATCAGA No data
Right 978578731 4:110211820-110211842 CATCAGAGAGAGACCATGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978578729 Original CRISPR TCTGATGCCTCTGATGGTGA AGG (reversed) Intergenic
No off target data available for this crispr