ID: 978578731

View in Genome Browser
Species Human (GRCh38)
Location 4:110211820-110211842
Sequence CATCAGAGAGAGACCATGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978578723_978578731 25 Left 978578723 4:110211772-110211794 CCAGTGGGCTGCCTTTTCCAACC No data
Right 978578731 4:110211820-110211842 CATCAGAGAGAGACCATGACTGG No data
978578726_978578731 4 Left 978578726 4:110211793-110211815 CCGTGATCCAGCCTTCACCATCA No data
Right 978578731 4:110211820-110211842 CATCAGAGAGAGACCATGACTGG No data
978578722_978578731 26 Left 978578722 4:110211771-110211793 CCCAGTGGGCTGCCTTTTCCAAC No data
Right 978578731 4:110211820-110211842 CATCAGAGAGAGACCATGACTGG No data
978578724_978578731 14 Left 978578724 4:110211783-110211805 CCTTTTCCAACCGTGATCCAGCC No data
Right 978578731 4:110211820-110211842 CATCAGAGAGAGACCATGACTGG No data
978578729_978578731 -7 Left 978578729 4:110211804-110211826 CCTTCACCATCAGAGGCATCAGA No data
Right 978578731 4:110211820-110211842 CATCAGAGAGAGACCATGACTGG No data
978578725_978578731 8 Left 978578725 4:110211789-110211811 CCAACCGTGATCCAGCCTTCACC No data
Right 978578731 4:110211820-110211842 CATCAGAGAGAGACCATGACTGG No data
978578728_978578731 -3 Left 978578728 4:110211800-110211822 CCAGCCTTCACCATCAGAGGCAT No data
Right 978578731 4:110211820-110211842 CATCAGAGAGAGACCATGACTGG No data
978578721_978578731 27 Left 978578721 4:110211770-110211792 CCCCAGTGGGCTGCCTTTTCCAA No data
Right 978578731 4:110211820-110211842 CATCAGAGAGAGACCATGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978578731 Original CRISPR CATCAGAGAGAGACCATGAC TGG Intergenic
No off target data available for this crispr