ID: 978584342

View in Genome Browser
Species Human (GRCh38)
Location 4:110261606-110261628
Sequence AATAACTACAAGAGTATAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5581
Summary {0: 8, 1: 424, 2: 977, 3: 1228, 4: 2944}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978584342 Original CRISPR AATAACTACAAGAGTATAAT TGG (reversed) Intergenic
Too many off-targets to display for this crispr