ID: 978595076

View in Genome Browser
Species Human (GRCh38)
Location 4:110368704-110368726
Sequence AAAAATGCTGATAATGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 688
Summary {0: 1, 1: 0, 2: 5, 3: 80, 4: 602}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978595076 Original CRISPR AAAAATGCTGATAATGAAAC TGG (reversed) Intronic
900145043 1:1155180-1155202 AAAATTGCTGAAAAGAAAACTGG - Intergenic
901367707 1:8767628-8767650 AAAAATGCTGCTTATCAAAAAGG + Intronic
902523876 1:17041326-17041348 AATTATGCTCATAATGAAATAGG - Intronic
903748861 1:25606653-25606675 GAAAATGAGGATAATGATACTGG - Intergenic
904220837 1:28967571-28967593 AAAACTGCTGAAAATGAAGGGGG - Intronic
905015602 1:34776526-34776548 AAAAATGGAGATAATGAATCAGG + Intronic
905379538 1:37551359-37551381 TGAAATGCTGATAAAGATACAGG + Intronic
906883292 1:49616736-49616758 GAAATTGCTGCTAATGAAATAGG - Intronic
907350156 1:53822787-53822809 AATAATGATGATAATGATAATGG + Intronic
907399506 1:54216287-54216309 AAAAATGCTGATAGAGGAGCTGG - Exonic
907914983 1:58860426-58860448 AAAAGTGCTGAGAATGCATCTGG + Intergenic
907998508 1:59657141-59657163 AATAATACTGATAATGTAATGGG - Intronic
908285391 1:62592747-62592769 ACAAATGCTTTTAATGAAAAAGG - Intronic
908371561 1:63485123-63485145 AATAATGCTATTAATGAAAATGG + Intronic
908820856 1:68085166-68085188 AGAAGTGCTGTTAATGACACAGG + Intergenic
908825430 1:68128417-68128439 AGACATGCAGATCATGAAACTGG - Intronic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909132978 1:71763011-71763033 AAAAATGCTAAAAATAAAAAGGG + Intronic
909236019 1:73153345-73153367 GAAAATGCTGATAGTGATAATGG - Intergenic
909416374 1:75410573-75410595 ATAAAGGCTGATAAGGAAAGAGG - Intronic
909640152 1:77863334-77863356 AGAAATGTGGAGAATGAAACAGG - Intronic
909785852 1:79611924-79611946 GAAAATCATGATAAAGAAACAGG + Intergenic
910252507 1:85212561-85212583 AAAAATGCTGAGAAGGTGACAGG - Intergenic
911072063 1:93839978-93840000 AAAAATGCTGACCATGAACCAGG - Intronic
911407731 1:97463659-97463681 AAAAATGCTGATAATGATAAGGG + Intronic
911567013 1:99474140-99474162 AAAGATGCTGCCAAGGAAACAGG + Intergenic
911933320 1:103932941-103932963 GAAAAGGCTGATAAAGAAGCAGG + Intergenic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912158830 1:106955775-106955797 AACAATGCTGATAATGCAAGTGG - Intergenic
912229051 1:107771237-107771259 AAAAAAGCTGACAAGAAAACTGG - Intronic
913020222 1:114781727-114781749 AATAATGCTGCTATTGCAACTGG + Intergenic
913680087 1:121181634-121181656 AATAATGCTGTTAATGAACATGG + Intronic
914031921 1:143969287-143969309 AATAATGCTGTTAATGAACATGG + Intronic
914157523 1:145098680-145098702 AATAATGCTGTTAATGAACATGG - Intronic
914404727 1:147359016-147359038 AAAAATGCTGAAAATTCAAAAGG + Intergenic
916253879 1:162766549-162766571 AAGAATGCAGAGAGTGAAACTGG + Intronic
916960180 1:169881757-169881779 AAAAATTGTGTTCATGAAACTGG - Intronic
917247917 1:173024484-173024506 AAAATTGGTGACAAAGAAACTGG - Intergenic
917564722 1:176201656-176201678 AAAATAGATGATCATGAAACAGG - Intronic
917687045 1:177427229-177427251 AAACATCCTGAAAATGAAAATGG + Intergenic
917771536 1:178285009-178285031 AAAAATGCTGAGAAAGAGAAGGG - Intronic
917973720 1:180225296-180225318 CAAAATGCAAATAATGAAAGGGG + Intergenic
918136466 1:181678433-181678455 AACAATAATGATAATAAAACAGG + Intronic
918214528 1:182381862-182381884 GAAAATGCTAAGGATGAAACAGG + Exonic
918623447 1:186631693-186631715 AGAAATACTAATAATGAAACAGG + Intergenic
918905088 1:190481505-190481527 AATAATGCTGCTAAATAAACTGG + Intergenic
919016615 1:192046172-192046194 TAAAATACAGATAATTAAACTGG - Intergenic
920098713 1:203503187-203503209 AAAAATGGAGAAAATCAAACTGG - Intronic
920314660 1:205068898-205068920 AACAAGGCTGATATTAAAACAGG - Intronic
920467397 1:206200170-206200192 AATAATGCTGTTAATGAACATGG + Intronic
920605537 1:207380431-207380453 AAAAATACTGAAAAAGAAAATGG - Intergenic
920720677 1:208383960-208383982 ACAGAAGCTGATAATGAAAAGGG - Intergenic
920723570 1:208412741-208412763 AAAAATGATGATGATGATAGTGG - Intergenic
920927780 1:210358837-210358859 CAAAATGCTGAGAGTGAAAAGGG + Intronic
921553715 1:216570571-216570593 CAAAATTCTTATAATGAAAGAGG - Intronic
921663164 1:217832437-217832459 ATAAATGCTGACAATAAAAATGG + Intronic
921753650 1:218826847-218826869 AAAAACCATGATAATAAAACAGG + Intergenic
921806961 1:219465917-219465939 ATAAATGTTCATAATGAAACAGG - Intergenic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
923073201 1:230584629-230584651 AAAAATGATGATAAAGAGAATGG + Intergenic
923569318 1:235100046-235100068 AAAAATGCTGGCAATTAAAAAGG + Intergenic
923952120 1:238968042-238968064 AAAAGTGCTGATAAAGAAAAAGG + Intergenic
1063041863 10:2349280-2349302 GAAAATGTTGATAATGAGCCTGG + Intergenic
1063173954 10:3535083-3535105 AACAATGCTTAAAATGAAACAGG + Intergenic
1063419744 10:5902252-5902274 AAACATCATGATAATAAAACAGG - Intronic
1064412805 10:15122133-15122155 AAAAATTCTGATATTGAGAAAGG - Intronic
1064577915 10:16764521-16764543 AAAAATGCTGAGTGTGAATCTGG + Intronic
1064843646 10:19625960-19625982 AAAAATCCTCATAATAACACTGG + Intronic
1064843968 10:19630171-19630193 AAAGAAGGAGATAATGAAACTGG + Intronic
1065166188 10:22980175-22980197 AAAAATGCTGATAATAATTTAGG - Intronic
1065795987 10:29308797-29308819 AAAAATACAGATAATAAAAATGG + Intronic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1066762211 10:38766139-38766161 AAAAATGCTACTAATGGAGCTGG + Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068367865 10:56075574-56075596 AAAAATGATGATAATGATGATGG - Intergenic
1068499828 10:57830795-57830817 AAAAAGGCTGAAAATAAATCTGG - Intergenic
1068631321 10:59301060-59301082 AGAAATGCTGGGAATGATACAGG + Intronic
1070257261 10:74824000-74824022 AAAACTGTTTATAATGGAACCGG + Intergenic
1071036266 10:81249700-81249722 AAAGATGATGATGATGATACAGG + Intergenic
1072355041 10:94600937-94600959 ATAAAAGTTGATAATGAAAACGG + Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073260255 10:102184314-102184336 AAAAATGCTGATAATGGGTCAGG - Intergenic
1074127774 10:110543367-110543389 AAGAATGGGAATAATGAAACAGG + Intergenic
1075151548 10:119937227-119937249 AAAAATACTTATAATGACAAAGG - Intronic
1076075218 10:127528746-127528768 AAAAATGATGATTTTGAAAGGGG - Intergenic
1076925959 10:133487377-133487399 AAATCTGCTGTTAATCAAACTGG + Intergenic
1077800501 11:5531420-5531442 AAAACTACTGTCAATGAAACAGG - Intronic
1078502548 11:11895746-11895768 AAAAAGGCTGTTAAAAAAACTGG - Intronic
1078827673 11:14945861-14945883 AAAAATTCTCATGATGAAATAGG + Intronic
1079269142 11:18966501-18966523 AAAAATGCTGCTCCTGAAAAGGG + Intergenic
1079515782 11:21266664-21266686 AAAAATGATGATGACAAAACCGG - Intronic
1079594416 11:22224493-22224515 ATAAATGATGCTGATGAAACTGG + Intronic
1079749168 11:24173928-24173950 CAAATTGCTGAAAATGAAGCAGG + Intergenic
1079942086 11:26693643-26693665 AAAAATTCTGGAAAAGAAACAGG + Intronic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080803376 11:35629890-35629912 AAAAATGCTAATGAAAAAACAGG + Intergenic
1080996708 11:37611819-37611841 GAAAATGCAGAGAATAAAACTGG + Intergenic
1081100203 11:38992413-38992435 AAAATTGCTGAGAAAGAAAAAGG - Intergenic
1081312738 11:41593590-41593612 AAAGAAGCTGCCAATGAAACAGG + Intergenic
1081797528 11:45831718-45831740 AAAACTGAAGAAAATGAAACAGG + Intergenic
1083072628 11:60001848-60001870 AGAAATGGTGATGCTGAAACAGG + Intergenic
1084951808 11:72670590-72670612 AAAAATAATGATAAAGAAGCAGG - Intronic
1085813937 11:79715755-79715777 AATAATGCTGATAATAAACATGG + Intergenic
1085974049 11:81630305-81630327 AACCATGATGATAATGAAAGAGG + Intergenic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087549835 11:99635141-99635163 AAAAATACTGAAAATTAAAAAGG - Intronic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088004954 11:104928130-104928152 AAAAATGCTGAAAACGCAAAAGG + Intergenic
1088293669 11:108268015-108268037 AAAAATACTTATAATTAAACAGG - Intronic
1088555855 11:111059834-111059856 AATAATGATGGTCATGAAACAGG - Intergenic
1089088260 11:115842482-115842504 AAAAATGCTGCACCTGAAACCGG - Intergenic
1090314776 11:125776581-125776603 CAAAATGCTGATAATGTGGCAGG - Exonic
1090504509 11:127297144-127297166 GAAAATGCTGATAATGGGCCAGG + Intergenic
1092951884 12:13511521-13511543 AAAAATGCTGACCATGAACATGG + Intergenic
1093241005 12:16674406-16674428 AAAAAGACTGATATTTAAACAGG - Intergenic
1095320269 12:40818756-40818778 AAAAATGCTGAAAACCAAAAAGG - Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095549134 12:43412596-43412618 AGAAATGCTGACAAGGAGACAGG + Intronic
1095593901 12:43937533-43937555 GAAAAGGCTGATAAGGAAGCAGG + Intronic
1095645423 12:44540111-44540133 AAAAATACATATAATTAAACAGG - Intronic
1097343751 12:58468239-58468261 AAAAATGGTGATAGTGATATGGG - Intergenic
1097533230 12:60832490-60832512 AAAAATGTTGATTATGCAATTGG - Intergenic
1097605741 12:61751373-61751395 AAAAATGCTGCTTGTGAAAATGG - Intronic
1097861845 12:64525569-64525591 AAAAAGGCTGAAAATGAAGTGGG - Intergenic
1098026454 12:66208462-66208484 AAAAATGCTGATAATACAGCTGG + Intronic
1098110472 12:67116559-67116581 AAAAATTCAGATAATGAAATAGG - Intergenic
1098718516 12:73863916-73863938 AAGGAAGCTGATAATAAAACAGG - Intergenic
1099013084 12:77314697-77314719 GATAGAGCTGATAATGAAACTGG + Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1099968834 12:89480062-89480084 AAATATGGTGATAATGGTACAGG - Intronic
1100055730 12:90507011-90507033 AAAAATGGAGATAGTTAAACTGG + Intergenic
1100872527 12:98925270-98925292 GGAAATGCTGATGATGAGACTGG + Intronic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101277143 12:103215351-103215373 TAAAAATCTGATAATGACACTGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1106421337 13:29588840-29588862 AAAACTGCTGAAAAAGAAAAGGG + Intronic
1106973380 13:35174055-35174077 AAAAAGCATGTTAATGAAACTGG - Intronic
1107112135 13:36709567-36709589 AAAAATGCTGAACAGGAAAAAGG + Intergenic
1108071499 13:46633862-46633884 AAAAATGCAGGAAAAGAAACAGG - Intronic
1108085300 13:46783184-46783206 AAAAGTGCTGATAGTGAGAGAGG - Intronic
1108113597 13:47103571-47103593 AAAAATGCTGAAAATCCAAAAGG + Intergenic
1108359764 13:49658379-49658401 ATAACTACTGATAATGAACCAGG + Intergenic
1109451463 13:62520066-62520088 CAAAATGCTGAGAAAGAAAATGG + Intergenic
1110304904 13:73974811-73974833 AAAAGTGATGATAAAGAACCAGG + Intronic
1110629234 13:77687403-77687425 AAAAATGATGATATTTTAACAGG - Intergenic
1110822759 13:79935673-79935695 GAAAATGCTGATAATCATAATGG - Intergenic
1110842624 13:80159771-80159793 AAAAATTCTGATCATGAAAATGG - Intergenic
1111070849 13:83166334-83166356 AAATATGGAGATAATAAAACTGG + Intergenic
1111192922 13:84832677-84832699 AAAAATAATGATAATGTCACGGG - Intergenic
1111209986 13:85064852-85064874 AAAACTGTTAAAAATGAAACAGG + Intergenic
1111459346 13:88519394-88519416 CAAGTTGCTGATAATGACACGGG + Intergenic
1111496982 13:89063612-89063634 GGATATGCTGATAATGAAATGGG - Intergenic
1112076260 13:95916456-95916478 AAAAATGCTGAAAATTCAAAAGG + Intronic
1113070819 13:106419477-106419499 GATAATGCTGATAAGGAACCTGG + Intergenic
1113150559 13:107258901-107258923 AAGTATGCTCATGATGAAACAGG + Intronic
1113519713 13:110931305-110931327 AAAAACGTTGAAAATGAAAGAGG + Intergenic
1114299736 14:21364569-21364591 ACTAATACTAATAATGAAACCGG - Intronic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114397186 14:22375449-22375471 AGAAATGCTCATAAAGCAACAGG + Intergenic
1115042184 14:28944376-28944398 GAAAATGCAGATAATAAAAGTGG - Intergenic
1115127869 14:30017969-30017991 AAATATGGTAAGAATGAAACTGG - Intronic
1116122561 14:40738869-40738891 TAGAAGGCTGATAATGAAACTGG - Intergenic
1116295990 14:43110625-43110647 AAAATTGCTTAAAATGAAAAGGG + Intergenic
1116601268 14:46926704-46926726 AAAAATGTTGCTACAGAAACAGG + Intronic
1116913379 14:50495403-50495425 AAAAAAGCAGAAAATAAAACTGG + Intronic
1117951997 14:61091985-61092007 AAAAATGGTGACGATGAAAAAGG - Intergenic
1117967490 14:61220814-61220836 AAAAAGGAAGAAAATGAAACAGG + Intronic
1118012127 14:61620513-61620535 AAAAATGCTGCTGTTGAACCAGG - Intronic
1119114084 14:72002251-72002273 CCAAATGCTGATAAAGAAATTGG + Intronic
1119213642 14:72851487-72851509 GAAAATGCTTATCATGAAGCAGG + Intronic
1119622301 14:76140253-76140275 AGAAAAGATGATAAAGAAACTGG + Intergenic
1120122408 14:80697615-80697637 AAAAATGCTGAATAGAAAACAGG + Intronic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1120799874 14:88676000-88676022 CAAAATGCTGATGATGACACAGG - Intronic
1121592549 14:95127564-95127586 AATAATGTTGTGAATGAAACAGG + Intronic
1121825195 14:97004504-97004526 AAAGATGCTGTTTATGAACCAGG + Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1202933545 14_KI270725v1_random:62395-62417 AAAAATGCTACTAATGGAGCTGG + Intergenic
1123399881 15:19973745-19973767 ATAAATGCTGACAATTAAATAGG + Intergenic
1124009587 15:25826814-25826836 AATAATGATGATAATGATAATGG + Intronic
1124144310 15:27108938-27108960 GAAAATGCTCATAATAAAATAGG + Intronic
1124230286 15:27939084-27939106 AAACATGTTGAAAATCAAACAGG + Intronic
1124825738 15:33093563-33093585 AACACTGCTGAGAATGAAAATGG - Intronic
1125228657 15:37426837-37426859 AAAGATGGTCATAATAAAACCGG + Intergenic
1125295508 15:38198618-38198640 AAAAATGCTGATACTGTGACTGG - Intergenic
1126000993 15:44209795-44209817 AAAGATGATGATAATGACAATGG - Intergenic
1126244379 15:46486991-46487013 AACAATTCTGAGAATGAATCTGG - Intergenic
1126278940 15:46919356-46919378 AATAAAGATGATAGTGAAACAGG - Intergenic
1126504114 15:49383356-49383378 AAAAATGCTGACACAGAGACAGG - Intronic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127000912 15:54503652-54503674 AGAAATGCTGATAATGAGTTTGG - Intronic
1127590337 15:60416094-60416116 AAAAATGCCGATAATGGGAAAGG - Intergenic
1127617239 15:60698782-60698804 ATAAATCCTGATAATTTAACTGG + Intronic
1128022827 15:64407776-64407798 AAAAACCTAGATAATGAAACTGG - Intronic
1128276040 15:66354877-66354899 ATAAAACCTGATATTGAAACTGG - Intronic
1131657674 15:94478504-94478526 AAAAATGCTGAAATTGATACTGG - Intronic
1131864002 15:96687483-96687505 AACAATTCTGAGAATGAAGCAGG + Intergenic
1131883372 15:96882496-96882518 TAAAAAGCTGATGATGAAACTGG - Intergenic
1131950327 15:97674357-97674379 AAAAATTCTCATAAAGAAGCTGG - Intergenic
1133149569 16:3817606-3817628 AAAACTCCTGATATTGAAAAGGG + Intronic
1133250227 16:4475978-4476000 AAGAATGCGAATAATGCAACAGG + Exonic
1133788046 16:8988189-8988211 GAAAATGGTGAAAATGAAGCTGG - Intergenic
1133806760 16:9131573-9131595 AAAAATATTGAAAATGGAACTGG + Intergenic
1133842016 16:9418485-9418507 AAAGCTGCTGAAAAGGAAACAGG - Intergenic
1133910398 16:10060646-10060668 AAAGATGATGATAATGAAGATGG - Intronic
1135110830 16:19689572-19689594 GAAACTGCAGAAAATGAAACTGG - Intronic
1135132883 16:19867431-19867453 TAAAATGCTCAGAATGATACCGG + Intronic
1135746292 16:25019555-25019577 ATTATTGCTGGTAATGAAACAGG + Intergenic
1136157609 16:28394579-28394601 AGAAATGCTGATGATGGAAAGGG + Intronic
1136205478 16:28720705-28720727 AGAAATGCTGATGATGGAAAGGG - Intronic
1137863764 16:51872470-51872492 ACAAAAGCTGATACTGACACTGG - Intergenic
1137903029 16:52289806-52289828 AAAAATATTGATTATGAAACCGG - Intergenic
1138045770 16:53723118-53723140 AAAAATAATAATAATGAAAGTGG - Intronic
1138211281 16:55165117-55165139 AACACTCCTGATAATGAAATAGG - Intergenic
1138380214 16:56595554-56595576 AAAAATGATCATAATGAGCCAGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1139901014 16:70328761-70328783 AAAAATGCTGAAAAGGTAATGGG - Intronic
1140910221 16:79444618-79444640 AAACATGCTGATGCTAAAACTGG - Intergenic
1140993626 16:80239092-80239114 AAAAATACTGAGAATGAAAAAGG - Intergenic
1141448994 16:84084275-84084297 AATCTTGCAGATAATGAAACTGG - Intronic
1142479505 17:210088-210110 AATAATGCTGACAAAGAGACAGG - Intergenic
1146986823 17:37227991-37228013 AAAAGGGCTGATAATCAAAGTGG - Intronic
1147526745 17:41232204-41232226 AATGATGCTGATGATGAGACGGG + Intronic
1147527254 17:41237763-41237785 AATGATGCTGATGATGAGACGGG + Intronic
1147530793 17:41275401-41275423 AACAATGCTGATGATGAGACGGG + Intergenic
1149083190 17:52683026-52683048 AAACATCCTTATAATGAGACAGG + Intergenic
1149308571 17:55372602-55372624 CAAAATACTGATAATGAATATGG + Intergenic
1149337161 17:55647547-55647569 AAAAATGCTCATAATAATAAAGG + Intergenic
1149501470 17:57156097-57156119 AAAAATAATGATAATAATACAGG - Intergenic
1149615841 17:57997673-57997695 AAAAATGCTGATATGGCAACTGG + Intronic
1149782186 17:59406859-59406881 AAAACTGCTGCTAATTCAACAGG + Intergenic
1149894187 17:60416363-60416385 AAGCATGATGATTATGAAACAGG + Intronic
1150318536 17:64190210-64190232 AAAAATGCTAAACATGAAAACGG - Intronic
1150548745 17:66190032-66190054 AAAAAACCTGAAAATGGAACGGG + Intronic
1150989944 17:70245553-70245575 TAAAATGATGATAATGATAATGG - Intergenic
1151524301 17:74653410-74653432 AAAAATTCTGTTACTGAAAAGGG + Intergenic
1153512124 18:5867260-5867282 AAAAATGCAAATAATTAAAAAGG + Intergenic
1153800219 18:8662177-8662199 GAAAATGATGAAAATGAAAATGG + Intergenic
1154340336 18:13497584-13497606 AAAAATGGTAATAATTAAAAAGG - Intronic
1155213474 18:23622067-23622089 AAAAATGCACAAAATCAAACAGG + Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156394662 18:36688527-36688549 AAACATGCTGCTAAAGAAATAGG + Intronic
1157658243 18:49414463-49414485 CCAAATAGTGATAATGAAACAGG + Intronic
1157662335 18:49456581-49456603 AAAAATGCAGGCAATGAAAGTGG - Intronic
1157712652 18:49860416-49860438 TAAAATGGTGATAATGATGCTGG + Intronic
1158200893 18:54939404-54939426 AAAAATGCAGATTCTGAATCAGG + Intronic
1158255787 18:55546935-55546957 AAAAATGGAGAAAAAGAAACAGG + Intronic
1158286163 18:55885940-55885962 AATAATGCAAATAATGAAAATGG + Intergenic
1158288127 18:55907689-55907711 AACGATGCTGATCTTGAAACTGG - Intergenic
1158388643 18:57023825-57023847 AGAAATGCTGATAATAAATTAGG + Intronic
1159011083 18:63058925-63058947 AAAATTGCTGCTCATGAAAATGG + Intergenic
1159371227 18:67529941-67529963 AAAAAGGCTATTAATGAGACAGG - Intergenic
1159418713 18:68186302-68186324 AAAAATAATGCTAATGAAAAAGG - Intergenic
1159726405 18:71965722-71965744 AAAAAAGCAGATGTTGAAACAGG - Intergenic
1159799975 18:72886485-72886507 AAAAATGGTGCTAATTATACAGG + Intergenic
1160346993 18:78140175-78140197 AAAAACACAGATTATGAAACAGG - Intergenic
1160475937 18:79187740-79187762 ACAACTGATGCTAATGAAACAGG - Intronic
1160768185 19:817996-818018 AATCATGCTGATAATGAAAGTGG - Intronic
1163038299 19:14584398-14584420 AAAAATAGAGAAAATGAAACCGG + Intronic
1163038991 19:14588659-14588681 AAAAATAGAGAAAATGAAACCGG + Intronic
1164013208 19:21227843-21227865 AAAAATTATGATAGTAAAACAGG + Intronic
1164413460 19:28025100-28025122 TAAAATGCTGAGCATGCAACAGG + Intergenic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
1168700445 19:58435892-58435914 AAAAATGCTGCTATAGAAGCTGG - Intronic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925551542 2:5081031-5081053 AAAAATCCTAATAATTAAAATGG - Intergenic
925947694 2:8880818-8880840 AAAAAGGCTGACAGTGAAATCGG + Intronic
926443298 2:12912821-12912843 AAAAATAATAATAATAAAACAGG - Intergenic
926490798 2:13523914-13523936 AAAAATACACACAATGAAACTGG + Intergenic
927114157 2:19885352-19885374 TAAAATCCTGATAATGAACTGGG - Intergenic
927409363 2:22806848-22806870 AAAAATGCTGACAATTACATGGG - Intergenic
928422670 2:31151056-31151078 AAAAATGCTGATTTTGCAGCTGG - Intronic
928831747 2:35494125-35494147 GTCAATACTGATAATGAAACAGG + Intergenic
929988726 2:46765393-46765415 AAAAATACTAAAAATGAAATGGG + Intergenic
930560379 2:52952936-52952958 AAAAATACAGATAAACAAACAGG + Intergenic
930583172 2:53236955-53236977 ACAAATGATAAGAATGAAACAGG + Intergenic
930766861 2:55093577-55093599 AAAGATGCAGATAATGACTCAGG - Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
931630796 2:64296756-64296778 CACATTGCTGATAATGAAAGAGG - Intergenic
931661742 2:64571272-64571294 AGAAATACTGAAAAAGAAACAGG - Intronic
932989608 2:76770699-76770721 AAAAATGCTGAATATGTAAAAGG - Intronic
933317679 2:80735511-80735533 AAAAATTATGATAGTGAAAGAGG + Intergenic
933533837 2:83546380-83546402 AATAATACTGATAAGGAAACTGG - Intergenic
934014126 2:87860275-87860297 AAAAATGCTGTCTATGAAGCAGG - Intergenic
935503601 2:103871412-103871434 AAAAATGCTCTTAAATAAACTGG - Intergenic
935509319 2:103951495-103951517 AAAAATGTGGATGATGAAAATGG + Intergenic
936695679 2:114944827-114944849 AAAACTCCTGATTATGAAACTGG - Intronic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937019587 2:118638348-118638370 AAAAATGCAGATTCTGAGACTGG + Intergenic
937659697 2:124416691-124416713 TAAAATGGTGATAATGATAATGG + Intronic
938190900 2:129279688-129279710 GGAGATACTGATAATGAAACAGG - Intergenic
938596804 2:132795518-132795540 AAAAATAGAGATAATGAAGCTGG + Intronic
938602813 2:132859998-132860020 AAAAATACTGAGATAGAAACAGG + Intronic
939336699 2:140838069-140838091 AAAAATTCTGAATAGGAAACTGG + Intronic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
939690283 2:145251253-145251275 AAAAATTATGGGAATGAAACAGG + Intergenic
940027304 2:149221960-149221982 AGAGCAGCTGATAATGAAACCGG - Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940532074 2:154890465-154890487 GAAAATGCAGATATTGACACAGG + Intergenic
940678033 2:156749061-156749083 AACAATGCTGCTAACCAAACTGG + Intergenic
940787947 2:158002150-158002172 AAAAATGGTAATAATAAAAGAGG + Intronic
941570359 2:167162117-167162139 CCGAATGCTGATAATGATACAGG - Intronic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
941586180 2:167362463-167362485 AAAAATGCTCTTATTAAAACAGG - Intergenic
941842895 2:170106924-170106946 ACACATGCTGAGAATGAAATGGG + Intergenic
941888981 2:170558312-170558334 AAAAATGCTTAAAACGAAAATGG + Intronic
943174381 2:184451171-184451193 AAAAATGCAGATAAGGACAAAGG - Intergenic
943546835 2:189291306-189291328 AATAATGCTGATTCAGAAACCGG - Intergenic
943811935 2:192197188-192197210 AGTAATTATGATAATGAAACAGG + Intergenic
943862438 2:192885372-192885394 AAAAATGTTGATAATTTAATAGG - Intergenic
944164524 2:196704538-196704560 AAAAATACTGATTTTAAAACTGG - Intronic
944641552 2:201731445-201731467 TAAAAGGCTGATGATGAAATCGG + Intronic
944725355 2:202465907-202465929 AAAAATGCTTATAATTAAGGTGG - Intronic
945444796 2:209924247-209924269 AAAAATCCTGATGAGGAAAGGGG - Intronic
945477961 2:210307909-210307931 TAAAACGCTGTTAATCAAACAGG + Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
946150424 2:217762501-217762523 AAAAATGCAGATGAAGAAACAGG - Intergenic
946518935 2:220445516-220445538 AAAAATACTAATAATAAAACTGG + Intergenic
947018007 2:225643007-225643029 AAAAATGCTGACCAGAAAACAGG + Intronic
947061830 2:226175587-226175609 AAAAATAATGAAAATCAAACTGG + Intergenic
947148588 2:227090885-227090907 AAAAAAGCTGAATTTGAAACAGG + Intronic
947161071 2:227215140-227215162 AAAAATGATGATGATGAGACTGG - Intronic
947293121 2:228599324-228599346 AAAAATGCAAAAAAGGAAACTGG + Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
947692933 2:232156141-232156163 AAAAGTGAGGAAAATGAAACTGG - Intronic
947882565 2:233531633-233531655 AACTATGCTGTTAATGAAAAAGG - Intronic
948686348 2:239672183-239672205 AAAAATGTTGATCATGACAGTGG - Intergenic
948724460 2:239923892-239923914 ACCAATGCTGGAAATGAAACAGG + Intronic
948773484 2:240266108-240266130 AAATATGCTGATTAAAAAACAGG - Intergenic
1169166306 20:3427232-3427254 AAATATGCTGATAAGAAAAAAGG - Intergenic
1169685141 20:8262606-8262628 AAACATTCAGATAATGAAGCTGG - Intronic
1169937888 20:10904436-10904458 AAAAATGCTGTTAGAGAACCAGG + Intergenic
1169951754 20:11052364-11052386 AAAAATGGTGATAATAATAAGGG - Intergenic
1170215931 20:13891292-13891314 AAATCTGCTGATAATGTTACAGG - Intronic
1170278642 20:14621114-14621136 AAAAATGAGGATAATAATACTGG + Intronic
1171073437 20:22098504-22098526 AAAAATAATTATAATGAAGCAGG + Intergenic
1171905654 20:30897474-30897496 AAAAATACTGAAAATGTAAAGGG + Intergenic
1171964178 20:31516897-31516919 TACAATGAGGATAATGAAACTGG - Intronic
1172655567 20:36535079-36535101 ACAAATGGTGCTAATGTAACTGG + Intergenic
1172721921 20:37005566-37005588 AAAAAATCTGTTAATGAAATGGG + Intronic
1173240808 20:41295384-41295406 AAAAATGCTTACAATGACATGGG + Intronic
1173779050 20:45738044-45738066 GAAAATGCTGATCATGGAGCAGG - Intergenic
1173968906 20:47135451-47135473 AATAATGTTGATAATGATAATGG - Intronic
1174336655 20:49866685-49866707 AAAAATATTGATAAAGAAATGGG - Intronic
1174699750 20:52596246-52596268 AAGAGTGCTGATAAAGAAAAAGG + Intergenic
1174992487 20:55526761-55526783 AAAAATGGTAATTATCAAACAGG + Intergenic
1175468774 20:59210764-59210786 TGAAATGCTGATGTTGAAACAGG - Intronic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1177312688 21:19417956-19417978 AAATATGCACATAATGAAGCAGG + Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177604557 21:23360804-23360826 CAAAACGCTGATAGTGATACGGG - Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177629895 21:23712846-23712868 AAAAATTCTTATAATAAGACAGG - Intergenic
1177736302 21:25094351-25094373 AAAACTGCTAATAATGAATGAGG + Intergenic
1178169900 21:30028656-30028678 AGAAATGCTGATAATCAAATTGG + Intergenic
1178490243 21:33045938-33045960 AAAATTGCTGAGAGTGGAACAGG + Intergenic
1178508145 21:33179928-33179950 AAAAATGCTTATTATGATAGAGG + Intergenic
1179032637 21:37734028-37734050 AGACCTGCTGATAATGAAGCTGG - Intronic
1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG + Intergenic
1180339062 22:11603571-11603593 AAAAATACTGAAAATGTAAAGGG + Intergenic
1180390264 22:12224440-12224462 AAAAATGTTCATAATTCAACAGG - Intergenic
1180415671 22:12710027-12710049 AAAAATGTTCATAATTCAACAGG + Intergenic
1180585029 22:16880544-16880566 AAAAATGCTACTAATGGAGCTGG + Intergenic
1180986204 22:19905226-19905248 AATCATGCTCAGAATGAAACGGG + Intronic
1183884305 22:40864769-40864791 AAAAACCCTGCTAATAAAACAGG - Intronic
949141257 3:636057-636079 AAAGATGGTGATAAGAAAACTGG + Intergenic
949228412 3:1721358-1721380 AAAAATGCCTAGAATGAAAAGGG - Intergenic
949466027 3:4344585-4344607 AAAAATGCTGAAAATCCAAAAGG + Intronic
949547689 3:5086092-5086114 ATCAAAGCTGATAAGGAAACTGG + Intergenic
950849197 3:16045877-16045899 AAAAATGCTGATAATGTATTTGG - Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951218053 3:20042097-20042119 TAAAATGCTGATTATGAATCAGG + Intronic
951437707 3:22684261-22684283 TATAATGCTGATAATTATACAGG - Intergenic
951791135 3:26486019-26486041 AAAAATACAGATAAAGAAAAAGG + Intergenic
951958460 3:28285752-28285774 AAAAATGCTGAGAATTTACCTGG - Intronic
952037462 3:29220038-29220060 AAAAAAGCTTATAATAAAACAGG + Intergenic
952411041 3:33050056-33050078 AAAAATGCAAATAAAGAGACAGG + Intronic
952543211 3:34389786-34389808 AAAAATGGAGATAATGGAAGAGG + Intergenic
952648559 3:35693532-35693554 AAAATTGCTGACAATGATTCAGG - Intronic
952973928 3:38677977-38677999 AAAATTTCTGATAATGACATGGG + Intergenic
953016167 3:39078735-39078757 AAAAATGCTGTTAATGGGCCGGG + Intronic
954514190 3:51157171-51157193 AAGTATGTTTATAATGAAACAGG - Intronic
954955162 3:54512435-54512457 AAGAATGATGATAGTGACACCGG + Intronic
955559848 3:60177026-60177048 AAAAATGCTCATAGGGAGACTGG + Intronic
956348112 3:68303094-68303116 AATAATGCTGATAATAGAAGTGG - Intronic
956806245 3:72815181-72815203 TAAAATTCTGATAATGAACCAGG - Intronic
957101950 3:75838715-75838737 AAAAATGTTCATAATTCAACAGG - Intergenic
957291465 3:78282362-78282384 AAAAATGCTGAAAATCCAAAAGG + Intergenic
957434017 3:80151406-80151428 AAAAATGCTGAAAATCCAAAAGG - Intergenic
957567388 3:81902714-81902736 AATAATGATGATGATGACACAGG + Intergenic
957584220 3:82113961-82113983 AAAAATGCTGAAAATCCAAAAGG - Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958645488 3:96866477-96866499 AAAAATACTGTAAATGAAAGTGG + Intronic
958680359 3:97322406-97322428 AAAAGTACTGCTAATGAAAATGG + Intronic
958979658 3:100706685-100706707 AAAAATCCTAAGAATGAAAACGG - Intergenic
959010819 3:101074002-101074024 AATAATGCTCATAATTAACCAGG - Intergenic
959166501 3:102785761-102785783 AAAAGTGCTGTTAATGAAACTGG - Intergenic
959221444 3:103525737-103525759 ATAAATGAGGATAATGAAAAGGG + Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959345385 3:105187864-105187886 ATAAAGGCTGATATTGAAAAGGG + Intergenic
959526566 3:107383949-107383971 ATAAATGGTGATAATGATACTGG + Intergenic
959598816 3:108156044-108156066 AACCATGCTGAAAATGAAACTGG - Intergenic
959669414 3:108958919-108958941 AAAAATGCTAATAAGAAAATTGG - Exonic
959843898 3:111010513-111010535 GAAAATGCAGATAAAGAAAATGG + Intergenic
960024685 3:112994993-112995015 AACTATGCTGATGATGACACAGG - Intronic
960531848 3:118773994-118774016 ACACATGCTGAAAATGACACAGG + Intergenic
960738835 3:120810542-120810564 AAAAATAATGATAATGAAAAGGG + Intergenic
962423307 3:135247334-135247356 AAATATGCTCATACTGTAACAGG - Intronic
962799213 3:138875604-138875626 AAAAAAGAAGAGAATGAAACAGG - Intergenic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
964258134 3:154803054-154803076 CAAAATGTTGATAATTAAGCAGG + Intergenic
964339457 3:155693068-155693090 AAAAATGCTGATGATTAGGCCGG - Intronic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
964814519 3:160702432-160702454 AAAAGTGCTGTTAATGACTCAGG + Intergenic
965265854 3:166542359-166542381 TAAAATGGTGATAATGAAAAAGG + Intergenic
965301818 3:167014337-167014359 AAAAATGAAGATAGAGAAACAGG - Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967002146 3:185345860-185345882 AAAAATTCTCTTCATGAAACCGG + Intronic
967243672 3:187465862-187465884 TAAAATGGTGATATTGAAACTGG - Intergenic
967542738 3:190687753-190687775 AAATTTGCTGATAATATAACAGG + Intergenic
967585289 3:191206433-191206455 AAAAATACTGAAAGTGAAAGAGG + Intronic
968639503 4:1705378-1705400 CAAACTTCTGATAATGAAGCAGG + Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
970949465 4:21736668-21736690 AAAAATACAGATAATGGAAGAGG - Intronic
971516756 4:27496866-27496888 AAAATTGCTGAAAATGCAAAAGG + Intergenic
971556352 4:28016956-28016978 AAAAATGATGATGATGAAAAAGG + Intergenic
971654360 4:29323211-29323233 AAAAATACTAAGAAAGAAACTGG + Intergenic
971901950 4:32671472-32671494 AAAAATATTGATAATGGAAATGG + Intergenic
972874508 4:43342020-43342042 AAAAGTGCTGAAACAGAAACAGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
973914220 4:55617178-55617200 AAGAATTCTGGTACTGAAACTGG - Intronic
974500809 4:62699508-62699530 AAAAATATTGCTAATGAAACTGG + Intergenic
974724105 4:65777061-65777083 CAAAATTCTGATAATGATACGGG + Intergenic
975001964 4:69235639-69235661 ATAAATGGTGATAAGAAAACTGG + Intergenic
975232947 4:71956166-71956188 AAAAATTCACATAATGGAACAGG + Intergenic
975393215 4:73844699-73844721 AAAAATCTTTCTAATGAAACAGG + Intronic
975489358 4:74971520-74971542 CAAAATGCTGTTAATAAAATAGG - Intronic
975622546 4:76308488-76308510 AAAAATGCTTACAATGGAAGGGG + Intronic
976368245 4:84255482-84255504 AAAAATGGTGTTGATGAAACAGG - Intergenic
976493244 4:85696210-85696232 ATAAAAGCTGATGATGAATCAGG - Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
978387370 4:108189630-108189652 TAAAATGCTTATAATAAGACTGG + Intergenic
978450297 4:108826015-108826037 AAAGATGCTGATTTTGAAATAGG - Intronic
978595076 4:110368704-110368726 AAAAATGCTGATAATGAAACTGG - Intronic
979043270 4:115828006-115828028 AAAAATGCTGATATTTTAATTGG - Intergenic
979095634 4:116546603-116546625 AAAAATGTCGTTCATGAAACTGG - Intergenic
979126409 4:116978883-116978905 AGAAATCCTGCTAATGCAACAGG - Intergenic
979491575 4:121334423-121334445 GAAAAGGGTGATTATGAAACAGG - Intronic
980303224 4:131021321-131021343 AAAAATGCTACAAATGACACAGG - Intergenic
980509470 4:133766239-133766261 ACAAATGCAGATAATGAATATGG - Intergenic
980649842 4:135697882-135697904 TAAAATTCTGAGACTGAAACAGG - Intergenic
980933007 4:139199274-139199296 AAGAATCCTGATAATTCAACGGG - Intergenic
981205746 4:142037800-142037822 AAAAATGGATATAATGAATCTGG + Intronic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982504503 4:156199300-156199322 TTATATGCTGATACTGAAACAGG - Intergenic
982857980 4:160409453-160409475 AAAAAAGTTAATAAAGAAACTGG + Intergenic
982992524 4:162296532-162296554 AGAAATGCTGAGAATTAAAAAGG - Intergenic
983029222 4:162778567-162778589 AAGAATGCTGATATTTTAACAGG + Intergenic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
985019612 4:185673841-185673863 ACAAATGCTGTTGATGAGACAGG - Intronic
985166918 4:187105780-187105802 AAAAATGATGCTAATTAAAAAGG + Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
985558651 5:570443-570465 ATAAAAGCTGATGAAGAAACAGG + Intergenic
987147875 5:15010474-15010496 AATAATAATGATAATGATACAGG + Intergenic
987241057 5:15999975-15999997 AAAAAAGCTGCAAATGAAAATGG - Intergenic
987599049 5:20041577-20041599 AACAATGTTGATAATGTCACAGG + Intronic
987732403 5:21792000-21792022 AAATCTGCTAATAATGACACAGG + Intronic
988294918 5:29344340-29344362 GAAACTGCTGAAAATGAAACTGG - Intergenic
988995522 5:36711358-36711380 GAAAATGCTGCTATTGAAATGGG - Intergenic
989111710 5:37913154-37913176 AAAAATGCCTACAAGGAAACAGG - Intergenic
989226062 5:39030341-39030363 AAATATGCTGATAACTCAACAGG + Intronic
989702304 5:44284369-44284391 AAAAATGGTAAGATTGAAACAGG - Intergenic
989711163 5:44399138-44399160 AAAAATGATGAAAATGAAATTGG - Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
991475885 5:67019062-67019084 AAAAAAGCAGATAATAAACCAGG - Intronic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
994037669 5:95221330-95221352 GAAAATGCTTAGGATGAAACAGG - Intronic
994180091 5:96754620-96754642 AAACATGCTAACAATGAAAATGG + Intronic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994626364 5:102225134-102225156 AGAAATTCTGATAAGGAAAATGG - Intergenic
994765712 5:103914622-103914644 AGAAATGCTGAAAATGTAAAAGG + Intergenic
994843048 5:104951127-104951149 AAAAATGCTGAAAATTCAAAAGG - Intergenic
994879331 5:105467350-105467372 AAAAATGCTCATCAGAAAACTGG + Intergenic
995135451 5:108675234-108675256 AAGAATGCTGACAGTGAAAGAGG + Intergenic
995629917 5:114121656-114121678 AAAAATGCTTATGAGGAAATAGG - Intergenic
995631695 5:114141080-114141102 AAAAATAATAATAATGAAGCAGG - Intergenic
995682333 5:114733458-114733480 AAAATTGCTGAAAATGAACATGG + Intergenic
995685237 5:114765676-114765698 AAAAATGCTGAAAACCAAAAAGG - Intergenic
996204838 5:120720271-120720293 AAGAATGATGAAAATGAAAAAGG - Intergenic
996215729 5:120862764-120862786 AAAAATGGTGGTAATTAAAATGG + Intergenic
996639195 5:125731331-125731353 AAAAATGCTGAAAATGCAAAAGG + Intergenic
997752790 5:136364708-136364730 AAATATGCTCCTAATGAAAGAGG - Intronic
998681768 5:144475566-144475588 AGGAATGCTGAAAATAAAACTGG - Exonic
999762172 5:154710992-154711014 AAAAATTCTGAAAATGAAAGTGG + Intergenic
1000060376 5:157650689-157650711 AAAAGTGATTATAATTAAACAGG - Intronic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000876331 5:166643029-166643051 AGAAAAGCTGATAATGGAAAAGG - Intergenic
1003144291 6:3496669-3496691 AATAATGGTAATAATGAAGCTGG - Intergenic
1003194129 6:3899882-3899904 GAAAAAGCTGTTAATGAAAGCGG - Intergenic
1003932385 6:10937705-10937727 AAAAAAACTGTTAATGAAAAAGG + Intronic
1004016307 6:11735123-11735145 AAATAAGCCCATAATGAAACAGG + Intronic
1004109991 6:12708383-12708405 TAAAATGCAGATTCTGAAACAGG + Intergenic
1004282092 6:14288833-14288855 AAAAATGTAGGTAATGAAAATGG - Intergenic
1004789514 6:19008691-19008713 AAAAATGGTGATAAGTAAAAGGG + Intergenic
1004809427 6:19243347-19243369 CAAAATGGTGCTAGTGAAACTGG + Intergenic
1004813214 6:19282943-19282965 AAAAATGCTCATAATAAATAAGG - Intergenic
1004964114 6:20828219-20828241 AATAATAATAATAATGAAACAGG - Intronic
1005397639 6:25399621-25399643 AAAAATGATGCTAATGAATGTGG + Intronic
1007455131 6:41971219-41971241 AATAATGCTTCTAAAGAAACTGG - Intronic
1008047068 6:46862235-46862257 AAAAATTCTGGTGATGCAACTGG - Intronic
1008229821 6:48971887-48971909 AAAAATCCTGATAATTAAGGAGG + Intergenic
1008563122 6:52741271-52741293 AAAAATTCTAAAAATTAAACAGG + Intergenic
1008674983 6:53809822-53809844 TAAAATGCCTTTAATGAAACAGG + Intronic
1008740451 6:54600747-54600769 AAAAATTCTGATAATTAACATGG - Intergenic
1009306355 6:62094784-62094806 ATAAATGGTGATGAGGAAACTGG - Intronic
1009562403 6:65264383-65264405 AAACATGCAGAGAATGAGACTGG + Intronic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1009732082 6:67621728-67621750 AAAAATACTGATAATGATATGGG + Intergenic
1009796635 6:68477742-68477764 AAAAATGCTGTTAATTGAAAGGG - Intergenic
1009994955 6:70887417-70887439 ATAAATGATGACCATGAAACTGG - Intronic
1010015595 6:71102381-71102403 AAAAATGCAAATAATTAAAGCGG - Intergenic
1010134174 6:72531223-72531245 CAAAATGCTGATATTGTAACTGG + Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1010774867 6:79873572-79873594 AAATATGTTGATAATGAGTCAGG + Intergenic
1011105736 6:83778298-83778320 GAGGATGCTGATAATGAAAGAGG + Intergenic
1011136014 6:84101885-84101907 GATAATGATGATAATGACACAGG - Intergenic
1011874113 6:91935339-91935361 AAAAGTGCTAATAATTAAACGGG + Intergenic
1011907730 6:92392732-92392754 AAAAATGGTGACAGTGAAACAGG - Intergenic
1011992766 6:93544366-93544388 AAAATAGCTGATAATGACAAAGG - Intergenic
1012319167 6:97821444-97821466 ACAAATGCTTATAATGCAAGAGG - Intergenic
1012500704 6:99885159-99885181 AAACATGGTGACAATAAAACTGG - Intergenic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1012640434 6:101604735-101604757 AAAAATGTTCATCATCAAACAGG - Intronic
1012768224 6:103396698-103396720 AAAAATGCTGACAATTCAAGAGG + Intergenic
1013112658 6:107076798-107076820 AATAATGTTGAAAATGAAAGTGG - Intronic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1013987583 6:116214098-116214120 AAAAATCCTGATACTGTAAGTGG + Intronic
1014019321 6:116569664-116569686 AAAAATTTTGTTAATGAAATAGG + Intergenic
1014566993 6:122961425-122961447 AAAAATACAGATAAATAAACGGG + Intergenic
1014662006 6:124184236-124184258 AGAAAGGCTGATAGTGAAAAAGG - Intronic
1014733379 6:125061302-125061324 ACAAATGCTCATACTGAAACAGG - Intronic
1015056967 6:128914777-128914799 AAACAGACTGATAATTAAACTGG + Intronic
1015190969 6:130471811-130471833 AAAAATGAGGATCATAAAACTGG + Intergenic
1015304821 6:131696100-131696122 AAAGATGATGATGATGAAAATGG - Intronic
1015398116 6:132757980-132758002 AAAAATGATGATAAAGTAAAAGG - Exonic
1015448060 6:133331410-133331432 AATAATGCTGATGATGACACAGG - Intronic
1015990842 6:138940986-138941008 AAAAATGTTTATAATGAAGATGG + Intronic
1016278002 6:142377762-142377784 AGATATGCTGAAAATGGAACTGG + Intronic
1016847210 6:148580358-148580380 ATAAATGGTGCTAAGGAAACTGG - Intergenic
1017481194 6:154857871-154857893 AAAAAAGCTTATTATGTAACAGG - Intronic
1017560098 6:155617524-155617546 ACAAATGAAGATAAGGAAACAGG - Intergenic
1018553929 6:165031011-165031033 AAAGATGCTGATGAGGAAATGGG + Intergenic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1019114025 6:169742248-169742270 TAAAATGGTGATGATAAAACTGG - Intronic
1020994855 7:15250782-15250804 AAAAATGCAAAAAATGAGACCGG + Intronic
1021744036 7:23720580-23720602 AAAAATACTGAAAATGTAAAGGG + Intronic
1022100208 7:27164904-27164926 AACAATGCTGAGAATGAGAGCGG - Exonic
1022584412 7:31592516-31592538 AAAACTACTTTTAATGAAACTGG - Intronic
1023274328 7:38501726-38501748 ATAAATTCTTAGAATGAAACTGG + Intronic
1023621593 7:42078668-42078690 AACAATGCTGAAAATTCAACAGG + Intronic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1024464175 7:49692840-49692862 AAAAATGGTGATAAAAACACTGG - Intergenic
1025534253 7:61928529-61928551 AAAGATGCTAACTATGAAACTGG + Intergenic
1027378453 7:77577925-77577947 CAAAATGTTGATAATGAAGCTGG + Intronic
1027559188 7:79705941-79705963 AAGACTGCTTATAATGAAAGAGG + Intergenic
1027740131 7:81991509-81991531 ACAAATTTTAATAATGAAACAGG + Intronic
1027981198 7:85224906-85224928 CAAACTGCTCAGAATGAAACTGG - Intergenic
1028565200 7:92222615-92222637 AAAAATGCTTTGAATGAAGCAGG + Intronic
1028722877 7:94053614-94053636 GAAAGTGCTGTTATTGAAACAGG + Intergenic
1028905478 7:96149649-96149671 AAAGGTGCTGAAGATGAAACAGG + Intronic
1028928601 7:96387985-96388007 AAATATGATGATATTGAAAAGGG - Intergenic
1029032866 7:97487464-97487486 AAAAAGGCAGATAATGAAGAGGG - Intergenic
1029962953 7:104707943-104707965 ATAAATGCTGAGAAAGAAAGAGG + Intronic
1030376986 7:108763807-108763829 AATAATGCTTAGAATGATACAGG - Intergenic
1030461831 7:109847583-109847605 GAAAATTTTGATACTGAAACAGG + Intergenic
1030474311 7:110010075-110010097 ATAAATGATGAAAATGAACCTGG - Intergenic
1030636668 7:111957341-111957363 CAAAAGGATGATAAAGAAACTGG + Intronic
1030747539 7:113185621-113185643 AAAAAGGCTGGTAAAGAAATCGG - Intergenic
1030827699 7:114181033-114181055 AAAAATGATGATAGAGAGACAGG - Intronic
1031073138 7:117184764-117184786 AAAAATGGTGAAAATGAACAAGG + Intronic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1032243714 7:130188691-130188713 TAAAAGGCTGTTAAGGAAACAGG + Intronic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1034571087 7:151957009-151957031 AAAAATGCTGATTATAAACTGGG + Intronic
1034942778 7:155242333-155242355 AAAACTGCTGATCCTGAAATAGG - Intergenic
1035481539 7:159191136-159191158 AATAAGGACGATAATGAAACAGG - Intergenic
1035664585 8:1371624-1371646 AAATTTGATGGTAATGAAACTGG + Intergenic
1036032506 8:4990288-4990310 TAATATCCTGATAATGCAACAGG + Intronic
1036179201 8:6568492-6568514 ATAAATGCTGAGCATTAAACTGG - Intronic
1037022717 8:13993518-13993540 TAAAATGCAGGTAATGGAACTGG + Intergenic
1039476205 8:37840635-37840657 AAAAATTCTGATAATTTAAAGGG + Intronic
1039611395 8:38922154-38922176 ATTATTGCTGATAATGAGACAGG + Intronic
1040996756 8:53410008-53410030 ATAAATGGTGCTAAGGAAACTGG + Intergenic
1041430048 8:57769819-57769841 AAAATTTCAGACAATGAAACAGG + Intergenic
1042219298 8:66457651-66457673 AAAAATGTTTTTAAAGAAACAGG - Intronic
1042834341 8:73064557-73064579 AAAATTGATGTTAATAAAACTGG - Exonic
1043057777 8:75461801-75461823 ACAATTGCTAATAATAAAACAGG + Intronic
1043157450 8:76801606-76801628 AAAAGTGATGAAAATGAAGCTGG - Intronic
1043844244 8:85146149-85146171 AGAAATTCTGATAATGTAACTGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044251538 8:90008566-90008588 TTATATGCTGTTAATGAAACAGG + Intronic
1044638076 8:94347604-94347626 AAAAATGATGATAAACAAAATGG + Intergenic
1044816056 8:96114213-96114235 AAAATTACTGATAATTAAAAAGG + Intergenic
1045229237 8:100285619-100285641 AAAAATTCTGACAATGATAAAGG - Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1046130524 8:109962348-109962370 CAAAATGCTGTTGATGAATCTGG + Intergenic
1046571603 8:115973137-115973159 AAAAGTGCTGATAATCATATAGG + Intergenic
1046634623 8:116660256-116660278 AAGAATTTTGAAAATGAAACAGG - Intronic
1048688124 8:136927294-136927316 AAATATGCTAAGACTGAAACAGG - Intergenic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1050890625 9:10819845-10819867 AAAAATGCTGAGAGTGATATGGG - Intergenic
1050910719 9:11066039-11066061 AAAAATTCTGATGCTAAAACAGG - Intergenic
1051493551 9:17694089-17694111 AAAAATCCTGGTAAGGAAATTGG + Intronic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1051895279 9:21980261-21980283 AATAATGTTAATATTGAAACTGG - Intronic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1053124293 9:35567171-35567193 AAAAATGCTTATAATGGGCCAGG + Intergenic
1054837180 9:69688723-69688745 AATAATGGGTATAATGAAACAGG - Intergenic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1056096869 9:83263670-83263692 AAAAGAGATGAAAATGAAACAGG + Intronic
1056238039 9:84615553-84615575 AAAAATCCTGTTAAAGAAAGTGG - Intergenic
1056784933 9:89584668-89584690 AAGAATGCAGAGAATGAAACTGG + Intergenic
1057846278 9:98527793-98527815 AAAAATGCCAAGAATTAAACTGG + Intronic
1058419679 9:104821710-104821732 AAAAATGCTCATACTAAAATTGG - Intronic
1058434318 9:104948186-104948208 AAATAGGCTTATAATGAAAGAGG + Intergenic
1059455406 9:114397493-114397515 AAAATTGCTGATAACAAACCTGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1060677798 9:125531661-125531683 AAAAATACTCATAATAAAATGGG - Intronic
1060975244 9:127761429-127761451 GAAGGTGCTGAGAATGAAACTGG + Intronic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1185764489 X:2714693-2714715 AAAAATGCAGATACAGAGACAGG + Intronic
1186245466 X:7611960-7611982 AAAAATCCAGATAAAGAAATCGG - Intergenic
1187131957 X:16511796-16511818 AACAAAGTTGGTAATGAAACTGG - Intergenic
1187329000 X:18318782-18318804 AAAGAGGCTGCTAATGAAATTGG + Intronic
1187822068 X:23298342-23298364 AATAATGGTGATAATGAACAAGG - Intergenic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188650315 X:32624034-32624056 AAACATGATGAAAATGAGACAGG + Intronic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1190785279 X:53641334-53641356 GAAAACACTGATAATGAATCAGG - Intronic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191212110 X:57896406-57896428 AAAAAAACTGTTAATGAACCAGG + Intergenic
1191919130 X:66235474-66235496 AACAAAGCTAAAAATGAAACAGG - Intronic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193110921 X:77729616-77729638 AAACATGATGATTTTGAAACTGG - Intronic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193534498 X:82696473-82696495 AAAAAAGTTGATAATAAAACTGG - Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194095944 X:89638590-89638612 AGAAATGCTGTCATTGAAACAGG - Intergenic
1194509428 X:94774555-94774577 AACAATACTGGTAATCAAACAGG - Intergenic
1194898733 X:99479862-99479884 AAAAATGGTGCTAAAGAAAATGG + Intergenic
1195509524 X:105698173-105698195 AATAATGATGATAATGATAGTGG - Intronic
1196607235 X:117671070-117671092 AAAAATGCTGAAAACCAAAAAGG - Intergenic
1196708610 X:118739400-118739422 AATATTGCTGATTATGTAACAGG + Intronic
1197035190 X:121865423-121865445 AAAAATAGTAATAATAAAACTGG - Intergenic
1197039434 X:121918221-121918243 AAAAATCCTTATAATCACACAGG - Intergenic
1197190243 X:123639124-123639146 AATAATGCTTATAATTAAAGTGG + Intronic
1197328146 X:125119814-125119836 AAAAATGAAGATGATGAAAATGG + Intergenic
1197550815 X:127890296-127890318 ATAAATGGTGATGAGGAAACAGG - Intergenic
1198193729 X:134338155-134338177 AAAAAAAAAGATAATGAAACTGG + Intergenic
1198626809 X:138584722-138584744 CAAAATGCTAATAATGCAAGCGG - Intergenic
1198911614 X:141621261-141621283 AAAAATATTGATAATGCAAGAGG - Intronic
1199130347 X:144178197-144178219 AAAAATGCTGTCTATGAAGCAGG + Intergenic
1199240330 X:145540935-145540957 AAAAAGGCAGACAATGAAACAGG - Intergenic
1199535695 X:148900455-148900477 AAATGTGCTGATAATGAGAGAGG + Intronic
1199731997 X:150643426-150643448 AAAAATACTGATAAGCAAAAAGG + Intronic
1200078412 X:153563554-153563576 GAGAATTCTGAAAATGAAACAGG - Intronic
1200448947 Y:3299973-3299995 AGAAATGCTGTCATTGAAACAGG - Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1200948666 Y:8870411-8870433 AAAATAAGTGATAATGAAACTGG + Intergenic
1201191738 Y:11449736-11449758 AAAAACGCTGCTAATGGAGCTGG + Intergenic
1201267748 Y:12224712-12224734 AAAAATGCCCATCATGTAACAGG + Intergenic
1201625790 Y:16012810-16012832 AAAAATGTTAAGAATGAAATTGG - Intergenic