ID: 978597318

View in Genome Browser
Species Human (GRCh38)
Location 4:110392313-110392335
Sequence CAGGGGAGACATTCTGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 269}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978597306_978597318 26 Left 978597306 4:110392264-110392286 CCATTCAAGCCCTGTGTTTGGAG 0: 1
1: 0
2: 4
3: 18
4: 144
Right 978597318 4:110392313-110392335 CAGGGGAGACATTCTGAAGATGG 0: 1
1: 0
2: 5
3: 26
4: 269
978597310_978597318 16 Left 978597310 4:110392274-110392296 CCTGTGTTTGGAGTAGGCAAGGA 0: 1
1: 0
2: 0
3: 11
4: 148
Right 978597318 4:110392313-110392335 CAGGGGAGACATTCTGAAGATGG 0: 1
1: 0
2: 5
3: 26
4: 269
978597308_978597318 17 Left 978597308 4:110392273-110392295 CCCTGTGTTTGGAGTAGGCAAGG 0: 1
1: 0
2: 1
3: 8
4: 146
Right 978597318 4:110392313-110392335 CAGGGGAGACATTCTGAAGATGG 0: 1
1: 0
2: 5
3: 26
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978597318 Original CRISPR CAGGGGAGACATTCTGAAGA TGG Intronic
901337325 1:8462414-8462436 GAGGGGAGACAGTGCGAAGAGGG + Intronic
901814719 1:11787627-11787649 CAGCTGAAACATTCCGAAGAGGG - Exonic
901865248 1:12102344-12102366 CAAGGGGGACTCTCTGAAGAAGG - Intronic
902973779 1:20074075-20074097 CAGGGGAGGCCTCCTGGAGAAGG + Intronic
903189279 1:21647761-21647783 CAGAGGAGGCATTCTAAAGAGGG + Intronic
904751948 1:32746384-32746406 CAGGGGAGGCTTTCTGGAGGAGG + Intronic
906158231 1:43626931-43626953 CAGGGGACACATTGAAAAGATGG + Intergenic
906523045 1:46478564-46478586 CAAGGGAGACTTCCTGAAGAAGG + Intergenic
908228586 1:62081473-62081495 CTGGTGAGACATCCTGGAGATGG - Intronic
910216579 1:84850095-84850117 CAGAGGAGACAGGCGGAAGAAGG + Intronic
910934522 1:92476412-92476434 AAAGGGAGACTTTCTGAAGGGGG + Intronic
911669223 1:100589439-100589461 TAGAGGAGAAATTCTGAATATGG + Intergenic
912507778 1:110167993-110168015 CAGGGGCAACATCCTCAAGAGGG - Intronic
914409432 1:147411632-147411654 CAGGGAGGACAATGTGAAGACGG + Intergenic
915263477 1:154696838-154696860 GAGGGGAGAGATCCTGAGGAGGG + Intergenic
915298759 1:154940317-154940339 CAGGGGAGGCATTCAGCAGAGGG - Intergenic
916463747 1:165051690-165051712 CAGGAGAGACAATGTGGAGATGG - Intergenic
917537888 1:175887707-175887729 CAGGGGAGAGATGCTGGCGAAGG + Intergenic
918414374 1:184291485-184291507 CAAGGAAGACTTTCTGAAGGAGG - Intergenic
918960656 1:191272633-191272655 CAAAGATGACATTCTGAAGAAGG - Intergenic
919646749 1:200102857-200102879 CAGGGAAGACTTCCTGAAGGAGG + Intronic
919958401 1:202441001-202441023 CAGGGAAGACTTCCTAAAGAAGG - Intronic
920336509 1:205248824-205248846 CTGGGGAGAGGTTCTGAACAAGG - Intronic
921680815 1:218028766-218028788 GAGGTTAGAAATTCTGAAGATGG - Intergenic
921756675 1:218864707-218864729 GAGGGGAGAAAGTATGAAGAAGG - Intergenic
1065770275 10:29071730-29071752 CTGGGGACACATTCAGAAGCTGG - Intergenic
1068082369 10:52335368-52335390 CAGGGGAGACAGGATGAAGCAGG + Intergenic
1068324899 10:55472002-55472024 CTGGTGAGATATTCTGAAGCAGG + Intronic
1069756921 10:70779115-70779137 CAGGGAAGAGATCCTGGAGAAGG - Intronic
1070389376 10:75955805-75955827 CATGGGAGAAAAGCTGAAGATGG + Intronic
1070515630 10:77203416-77203438 CAGGGGAGGCTTTCTGGAGGAGG - Intronic
1070782076 10:79143478-79143500 CAAGGGAGGCTTTCTGGAGAAGG - Intronic
1073022970 10:100462198-100462220 TAGGGGAGGTTTTCTGAAGAAGG - Intergenic
1074955696 10:118386698-118386720 GAAGGGAGACAGTCTGTAGAGGG + Intergenic
1075419963 10:122293449-122293471 CAGGGGACACACATTGAAGAGGG + Intronic
1075549676 10:123383017-123383039 CAGGGGAGGCTTCCTGAAGCAGG + Intergenic
1075787581 10:125060645-125060667 CAGGGCAGTCATGCGGAAGAGGG + Intronic
1076003723 10:126931670-126931692 CAGGGAAGCCATTCTGAAGCGGG + Intronic
1076056135 10:127374758-127374780 CAGGCTAGACCTTGTGAAGATGG + Intronic
1077403048 11:2368430-2368452 GAGGGGAGACACCCTGGAGAGGG + Intergenic
1078107271 11:8366197-8366219 CAGGGGAGGCTTCCTGGAGAAGG + Intergenic
1078401252 11:11029301-11029323 CAGGGAAGAGGCTCTGAAGAGGG + Intergenic
1080233442 11:30043514-30043536 TAGGGGAGACTTTCTGAAAGAGG - Intergenic
1081595865 11:44459086-44459108 CAGGGCAGACATTTTGGAGAGGG + Intergenic
1082774222 11:57233643-57233665 CAGTGCAGATATTCTGAAGAAGG + Exonic
1084431480 11:69113859-69113881 CAGGGGAGGCCTCCTGAAGAGGG - Intergenic
1084732423 11:71082057-71082079 CCGGGGGGACATTGTGAACAGGG - Intronic
1085013335 11:73156585-73156607 CAGGGGAGACTTTCTGCAGGAGG + Intergenic
1085061008 11:73447138-73447160 CAAGGAAGACATTTTGGAGAAGG - Intronic
1086999933 11:93407428-93407450 ATGGGGACACATTCTGAAAAAGG - Intronic
1088227266 11:107635014-107635036 CAGGGGAGACAGTGCTAAGAGGG - Intronic
1089069039 11:115684529-115684551 CAGGAGAGAAATTATGATGAGGG + Intergenic
1089756917 11:120694042-120694064 CAAGGGAGACATTCAGCAGGGGG + Intronic
1090335397 11:125959544-125959566 CAAGGGTGACATTCTGAAAAAGG + Exonic
1090702430 11:129308721-129308743 CAGTGGAGACATGCTGAAGATGG + Intergenic
1090845768 11:130528513-130528535 CAGGGGAGGCATGCGGAACATGG + Intergenic
1090963682 11:131579923-131579945 CAGGGCAGCCATTCTAAATATGG - Intronic
1091440055 12:505625-505647 CAGTGGGAACATTCTGAAAATGG - Intronic
1091446136 12:545202-545224 CCTGGGAGACAGTGTGAAGATGG - Intronic
1093219277 12:16399621-16399643 GAGGGGAGTGATGCTGAAGAAGG - Intronic
1095374211 12:41506831-41506853 CAGGGGAGACATTTTCCAAACGG - Intronic
1096252058 12:50039840-50039862 CAGGGAAGCCATTCTGAAAGTGG + Intergenic
1096252522 12:50042136-50042158 CCAGAAAGACATTCTGAAGAGGG + Intergenic
1098850276 12:75587979-75588001 CAGAGGAAATATTCAGAAGAAGG - Intergenic
1099158382 12:79208603-79208625 CTGCGGAGAATTTCTGAAGAAGG + Intronic
1099945190 12:89235845-89235867 CAGAGGAGGCTTCCTGAAGAAGG - Intergenic
1100531614 12:95466697-95466719 AAGGGAAGACCTTCTCAAGAAGG - Intergenic
1101202534 12:102451933-102451955 CAGGTGAGAGAGTGTGAAGAGGG - Intronic
1101453542 12:104805664-104805686 AAAGGAAGACATTATGAAGAAGG + Intronic
1102052789 12:109875242-109875264 TAGGAGAGACATTCTGGATAAGG + Intronic
1102923542 12:116810239-116810261 CAGCAGAGACTTCCTGAAGAAGG + Intronic
1107130465 13:36888758-36888780 GTGGGGAGACATTCTGAAATGGG + Intronic
1107419974 13:40237030-40237052 CAGAGGAGCCATTCTCGAGATGG + Intergenic
1108750365 13:53441734-53441756 CACGGACAACATTCTGAAGAAGG - Intergenic
1112211243 13:97379790-97379812 ATGAGGAGACATTCTGGAGATGG + Intronic
1112418162 13:99222154-99222176 CAGGGTTTACATTCTGATGAAGG + Intronic
1113630315 13:111878043-111878065 CAGGAGCGACATTCTCCAGATGG - Intergenic
1113918728 13:113891460-113891482 AAGGTGAGACATTGTGAAGCAGG - Intergenic
1114298646 14:21353813-21353835 CAGGGGAGTGATGCTGAAGAAGG - Exonic
1114334598 14:21675233-21675255 CAGGGGACACATTAAGAACAGGG + Intergenic
1114794078 14:25692656-25692678 CTGGGGAGTAATTGTGAAGATGG + Intergenic
1115905740 14:38201353-38201375 CAGGGTAGAGCTTGTGAAGAGGG - Intergenic
1115998627 14:39219304-39219326 CGGGGGCCACATGCTGAAGATGG + Intergenic
1117590761 14:57265804-57265826 CAGGATAGACATTCTGAGTAAGG - Intronic
1118359182 14:65041709-65041731 CGGGGGAGGCTTTCTGAAGGTGG - Intronic
1121583110 14:95045335-95045357 CTGGGGAGACAGTGTGAACAAGG - Intergenic
1122026574 14:98881920-98881942 CAGGGCAGACATTCTGCCCAAGG - Intergenic
1122160340 14:99779776-99779798 GAGGGGAAGCATCCTGAAGATGG - Intronic
1122198771 14:100109227-100109249 CAGGGAGGACAGACTGAAGAAGG - Intronic
1122472826 14:101983471-101983493 AAGGGAAGAAAATCTGAAGATGG + Exonic
1122600164 14:102917420-102917442 CAGGGGAGGCTTCCTGAAAAAGG - Intergenic
1123771854 15:23537079-23537101 CAGGTGAGACATAATGAGGAAGG - Intergenic
1124414241 15:29461850-29461872 CTTGGAAGACGTTCTGAAGATGG - Intronic
1126020342 15:44394306-44394328 CAGGGGATACATTCTGAGAAAGG + Intronic
1127836849 15:62797216-62797238 CAGGGAGAACATTCTCAAGACGG + Exonic
1128025658 15:64434596-64434618 GAGTGGAGATATTCTGAAGATGG + Intronic
1128536437 15:68494182-68494204 CAGAGGAAGCATTCTGAGGAAGG - Intergenic
1128564850 15:68694211-68694233 CAGGGAAGACTTTCTGCAGGAGG + Intronic
1128804808 15:70522767-70522789 CAGGGAAGACTTCCTGAAGGCGG + Intergenic
1129508435 15:76102406-76102428 CAGGGGAGTCTTTGTGAATAAGG + Intronic
1129740889 15:77989073-77989095 CAGGGAAGGCCTTCTGAGGAGGG + Intronic
1129868577 15:78926606-78926628 CAGCAGCAACATTCTGAAGAGGG + Intronic
1130095547 15:80853073-80853095 CAGGAGAGACATTGAGAATAGGG + Intronic
1130776353 15:86988068-86988090 ACGGGGAGACATGCAGAAGAAGG - Exonic
1130879347 15:88041791-88041813 CTGCGGAGACTTGCTGAAGATGG - Intronic
1132248072 15:100312691-100312713 CAGGGTGGACTTTCTGGAGAAGG + Intronic
1132870662 16:2114397-2114419 CAGGGCAGACATTCTCAAAGCGG + Exonic
1133085241 16:3357099-3357121 CAGGGGAGACATGTTGTTGAGGG + Exonic
1133880358 16:9776201-9776223 CAGGGAAGACTTCCTGAAGGTGG - Intronic
1133894434 16:9912403-9912425 CAGGGGCTACGTTCTGAAAATGG - Intronic
1133916658 16:10115151-10115173 CTGGAGAGACAGTCTTAAGACGG + Intronic
1137720832 16:50626445-50626467 CAGGGGAGGCCTCCTGAAGGAGG + Intronic
1138245297 16:55462827-55462849 CAGGGGAGAGCTTCTGGACAGGG + Intronic
1138637929 16:58357877-58357899 CAGGGGGGAGAGTGTGAAGAGGG - Intronic
1140060437 16:71564812-71564834 CAGGGTAGACAGGCTGAAAAAGG + Intronic
1141484823 16:84331746-84331768 CAGGGAAGACATCCTGGAGGTGG + Intergenic
1141946026 16:87310739-87310761 CAGGGGAGAGAGTCAGAGGAGGG + Intronic
1141965018 16:87436287-87436309 CAGGCTAGCCATTCTGCAGAGGG - Intronic
1143879064 17:10015830-10015852 CAGGGGAGGCTTCCTGGAGAAGG - Intronic
1147049960 17:37786822-37786844 CAGGGAAAGCTTTCTGAAGATGG + Intergenic
1147057694 17:37846831-37846853 CAGCGGAGTCATGCTGCAGAGGG - Intergenic
1147117785 17:38314955-38314977 CAGGAGAGACATAATGAAGTGGG - Intronic
1147725506 17:42564163-42564185 CAGGGGTTACATTCTCAAGGCGG - Exonic
1151116059 17:71736542-71736564 AAGGGGAGAAATTCTGAATAGGG - Intergenic
1151608172 17:75153659-75153681 AAGGGGAGACACTTGGAAGAGGG + Intronic
1152146539 17:78572068-78572090 CAGGGGAGCCATCTTGAATAGGG - Intronic
1152653670 17:81509404-81509426 CAGGGGAGAGCCTCTGTAGATGG - Intergenic
1152660891 17:81541404-81541426 CACAGGAGACATGCTGGAGAGGG + Intronic
1153919198 18:9773128-9773150 GAGGCGAGACCTTCTGGAGAGGG + Intronic
1155397086 18:25397995-25398017 CGGGGCAGACATTGTCAAGAAGG + Intergenic
1155963419 18:32014792-32014814 TAAGGGAGACATGCTGAGGATGG + Intergenic
1156181173 18:34606657-34606679 CAGAGAAGACATCCAGAAGAAGG + Intronic
1156556470 18:38074424-38074446 CAGGGGAGACATTTTGCAGGGGG + Intergenic
1157594899 18:48858552-48858574 CAAGGGAGGCTTTGTGAAGAAGG + Intronic
1158062277 18:53359633-53359655 TAGAGCAGACATTGTGAAGAGGG - Intronic
1159117964 18:64136709-64136731 CAGAAGAGACAATATGAAGAAGG + Intergenic
1162327339 19:10006990-10007012 CAGAGGAGACATTCAGAGGGAGG - Intronic
1166193878 19:41193811-41193833 CAGGTGGGGCATGCTGAAGAGGG + Intronic
1166855108 19:45779444-45779466 CAAGTGGGACATGCTGAAGAGGG - Exonic
1167554903 19:50188389-50188411 CAGGGAAGACATCCTGAAGAAGG + Intronic
1168298595 19:55390205-55390227 CACTGGAGACTTTCTGGAGATGG + Intronic
1168457436 19:56524252-56524274 CAAAGGAGACATTGTGAAAAAGG - Intronic
926434548 2:12824697-12824719 CAGGAGAGACACTTTGAGGAGGG - Intergenic
926615394 2:14992015-14992037 CAGGGAAGGCTTTCTGAAGGTGG + Intergenic
926734071 2:16059190-16059212 CAGGGGAGTCATTCAGCAGCAGG - Intergenic
926752840 2:16212041-16212063 CAGGGGAGAAAGGCTGGAGAAGG + Intergenic
926812752 2:16771035-16771057 CAGGGGAGACTCCCTGGAGAAGG - Intergenic
928333574 2:30376631-30376653 CAGGAAAGACTTTCTGGAGAAGG - Intergenic
928632221 2:33205657-33205679 CATGGGACTCATTCTGAACAGGG - Intronic
929105709 2:38363903-38363925 CAATAAAGACATTCTGAAGACGG + Intronic
932080151 2:68706892-68706914 CAGGGGAGAGATCCTGGAGGAGG - Intronic
933204396 2:79488796-79488818 CAGGAGAGGCTTTCTGAGGAGGG - Intronic
933391432 2:81673829-81673851 CAGGAGAGACAGTCTGAAGAGGG - Intergenic
934556563 2:95289730-95289752 CAGTGGAGATATGGTGAAGAGGG - Exonic
936527944 2:113254890-113254912 CAGGGAAGACTTTCTGTAGGAGG - Intronic
938120862 2:128632156-128632178 GAGGGGAGAAATGCTGGAGAAGG - Intergenic
938251922 2:129822080-129822102 GTGGGGAAACATTATGAAGAAGG - Intergenic
938380560 2:130834166-130834188 CAGGGGAGCCGTTGTGAGGAGGG - Intergenic
940366468 2:152853500-152853522 GAGGCAAGAAATTCTGAAGAGGG - Intergenic
940718708 2:157258217-157258239 CAAGGAAGACATTGTGAGGAGGG + Exonic
942099712 2:172568014-172568036 CAGGTGAAACATTTTGAAAATGG + Intronic
943082691 2:183275585-183275607 AAGGGGACATATGCTGAAGAGGG + Intergenic
947760625 2:232601135-232601157 CAGCGGTGACATTCTGGAAAAGG + Intergenic
1168996363 20:2136100-2136122 CAGGGGACACATTCTGAGGCCGG + Intronic
1171015371 20:21536582-21536604 CATGGGAGCCATTTTGAAGAGGG + Intergenic
1171346926 20:24472207-24472229 CAGGGGTGAGATATTGAAGAAGG + Intronic
1171937364 20:31287708-31287730 CAGGAGAGACATCATGATGAGGG - Intergenic
1173927027 20:46788312-46788334 CTGGAGAAACTTTCTGAAGAAGG - Intergenic
1173984252 20:47248751-47248773 CAGGGGAGACTTCCTGGAGGAGG + Intronic
1175907882 20:62390611-62390633 CAGGGGAGACACACTGCAGCCGG + Exonic
1178165607 21:29972363-29972385 CAGAGAAGACAGTCTGGAGAGGG + Intergenic
1178390884 21:32197217-32197239 AAGGACAGACATTGTGAAGAAGG - Intergenic
1178629731 21:34248714-34248736 CAGGAGAGACCATCTGGAGAAGG + Intergenic
1180703814 22:17796652-17796674 CAGGTGTGACATTCTGATCAGGG - Intronic
1181953656 22:26572599-26572621 CAGGGAAGGCTTCCTGAAGAAGG - Intronic
1182285524 22:29244826-29244848 CAGGGGAGACATCTGGAAAATGG + Intronic
1182487717 22:30649313-30649335 AATGGGAGACATTTTGCAGATGG - Intronic
1182895325 22:33855009-33855031 CCGGGCAGTCATTCTGGAGAAGG + Intronic
1183083704 22:35473712-35473734 CTGGGTAGACCTTCTTAAGATGG - Intergenic
1183726707 22:39594003-39594025 CTGGGGAGACACACTGAAGATGG + Intronic
1184543875 22:45152106-45152128 CAGGGAAGACTTACTGGAGAAGG + Intergenic
1184546581 22:45173704-45173726 AAGGGAAGCCATTCTGAAGGAGG + Intronic
1184558902 22:45249977-45249999 CAGGGGAAACATTTTGATAAGGG + Intergenic
950030172 3:9846973-9846995 CAGGAGGGACTTTCTTAAGAAGG + Intronic
950122186 3:10489167-10489189 CAGGGAAGACTTTCCTAAGAAGG - Intronic
950435580 3:12977522-12977544 CAGGTGAGATGTTCTGAAGGAGG - Intronic
952361695 3:32636615-32636637 CAGGGTAGACCTCCTTAAGAAGG - Intergenic
954647307 3:52139542-52139564 CAGGGGAGGCTTCCTGGAGAAGG - Intronic
955489828 3:59471056-59471078 AAGGTGAGACATTTTGAAGTAGG + Intergenic
960484962 3:118240315-118240337 GAGGGGAGACATTGCTAAGAAGG + Intergenic
960995963 3:123340382-123340404 CAAGGAAGACATCATGAAGATGG - Intronic
962663327 3:137627412-137627434 CAGAGGAGGCAGTGTGAAGACGG - Intergenic
963310559 3:143706111-143706133 CAGGGGAAAAATTCAGAATATGG - Intronic
964835173 3:160930066-160930088 CAAGGGAGAGTTTCTGAGGAAGG - Intronic
965633728 3:170759583-170759605 TTGGGGAGACCTTCTGAGGAAGG - Intronic
965857753 3:173109248-173109270 CATGGGAGAAGTTGTGAAGAGGG - Intronic
966889971 3:184399801-184399823 CAGGGAAGACCTTCAAAAGAAGG + Intronic
969581738 4:8069248-8069270 CAGTGGGGACGTTCTGAACAAGG + Intronic
969977113 4:11114901-11114923 CAGAGGAGACCATGTGAAGATGG - Intergenic
971089236 4:23320968-23320990 CAAGGGAGACATTCATATGATGG + Intergenic
973731080 4:53822829-53822851 AAGGGCAGACATTCTGAGCATGG + Intronic
974062974 4:57052316-57052338 CAGGGGTGTCAGTCTGAGGAAGG + Intronic
976763457 4:88574521-88574543 CAGGTGAAAGATTCTGGAGATGG - Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
977870642 4:102086388-102086410 CAGGGGAGGCCTTTTGGAGAAGG - Intergenic
978597318 4:110392313-110392335 CAGGGGAGACATTCTGAAGATGG + Intronic
979522945 4:121689323-121689345 CGGGGGAGACATTCAAAAGATGG - Intronic
985009649 4:185569254-185569276 CTGGGGAGACTGCCTGAAGAGGG + Intergenic
990556302 5:56939965-56939987 AAGGGAATACATTCTGAAAAAGG - Intronic
991518580 5:67467865-67467887 CAGGGGAGAGATACAGAAGAAGG + Intergenic
995206339 5:109485549-109485571 CAAGGGAGGCTTCCTGAAGAAGG + Intergenic
995434792 5:112123496-112123518 CAGTGGTCACATTCAGAAGAGGG - Intergenic
995477877 5:112566049-112566071 CAGGGAAGAAATGCAGAAGAAGG - Intergenic
999687664 5:154117195-154117217 CAGGGGACCCATGCTGAGGAGGG + Intronic
1000028101 5:157377429-157377451 TAGGGAAGACTTTCTGAAGAAGG - Intronic
1000849854 5:166326517-166326539 CTGGGGTGACTCTCTGAAGAAGG - Intergenic
1001049770 5:168404819-168404841 CAGGGGTGAGCTTCTGGAGAAGG - Intronic
1002398391 5:178975999-178976021 CAGGGGAGAAAATGTGAGGAAGG - Intergenic
1002667354 5:180834882-180834904 CAGGGGACACATTCAGATCATGG + Intergenic
1002686826 5:181018942-181018964 GAGTGTAGACATTCTCAAGAGGG + Intergenic
1004391061 6:15210207-15210229 CAGAAGAGCCATTCTGAGGAAGG + Intergenic
1006055179 6:31378796-31378818 TGGGGGAGACATACTGAGGAGGG - Intergenic
1006119296 6:31794783-31794805 GAGGGGAGAAATTCAGAGGAGGG - Intronic
1006239924 6:32668691-32668713 CAGGTGAGACACTCGGAATAAGG - Intergenic
1006529290 6:34636883-34636905 CAGGTAAGAAATTCTTAAGAAGG - Intronic
1006767331 6:36519406-36519428 CAGGGGAGACAGGCAGATGAAGG - Intronic
1006866855 6:37215715-37215737 CAGGGGAGGCTTTCTGGAGTAGG + Intronic
1007166890 6:39834931-39834953 CAGGGAAGGCTTTCTGGAGAAGG - Intronic
1007558604 6:42786856-42786878 AAGGGGAGAAATTATGAATAGGG + Intronic
1008187510 6:48412168-48412190 CCGGGACGGCATTCTGAAGATGG + Intergenic
1008387179 6:50905135-50905157 TAGGGCAGTCATTTTGAAGATGG + Intergenic
1008787702 6:55189401-55189423 CATGAGAGGCAGTCTGAAGATGG + Intronic
1009445065 6:63732979-63733001 CAGGAAAGGCATTATGAAGAAGG + Intronic
1009729375 6:67579792-67579814 GAAAGGAGACATTCTGAAAAGGG - Intergenic
1012124252 6:95407607-95407629 CTGGGGAGACATTTTGAAGGAGG + Intergenic
1012252791 6:96997362-96997384 TAGGGGATAAATTCTGGAGAGGG - Intronic
1014346202 6:120272768-120272790 TAGGATAGACATTCTGAAAAGGG + Intergenic
1014774346 6:125491211-125491233 CAAAGGACACTTTCTGAAGAGGG + Intergenic
1016001285 6:139043973-139043995 CAGGGGAGATATCCTGGAGGGGG + Intergenic
1016035457 6:139378508-139378530 CAAGGAAGACTTTCTGGAGAAGG + Intergenic
1016193321 6:141298193-141298215 CAGGAGAGACTTTCAGCAGAAGG - Intergenic
1016792212 6:148077882-148077904 CAGGGGAAACACCCTGAAGTAGG + Intergenic
1018164283 6:161078805-161078827 CATAGGTGACAGTCTGAAGAGGG + Intronic
1020126275 7:5534057-5534079 CAGGTGATAAATTCTGAGGAGGG - Intronic
1021770896 7:23999902-23999924 CAGGGGAGAAATTCCGAATACGG - Intergenic
1021931043 7:25581667-25581689 GAGGGGAGTCATCCTGGAGAAGG - Intergenic
1022109384 7:27219288-27219310 CAAGGGAGACATAATGAAGGAGG + Intergenic
1022834731 7:34102739-34102761 CAGGGGACACATTATGATCAGGG + Intronic
1024986041 7:55194042-55194064 GAGGAGATACATTCTGAAAATGG - Intronic
1028958479 7:96721532-96721554 CAGGGTAGAACTCCTGAAGAAGG + Intergenic
1030175476 7:106649300-106649322 CAGCTCAGACATTCTTAAGAAGG + Intergenic
1032852696 7:135808822-135808844 GAGGGGAGAAATTCTGAACTTGG - Intergenic
1033461453 7:141550893-141550915 CAGGGGAGAGAGCCTGGAGAGGG - Intergenic
1035296559 7:157870676-157870698 TATGGAAGAGATTCTGAAGAAGG - Intronic
1035313950 7:157986788-157986810 CAGAGGAGACATTTTGGAGCAGG + Intronic
1037109423 8:15147797-15147819 GGGGGAAGACATGCTGAAGAAGG + Intronic
1037627361 8:20619800-20619822 CAGAGGAGACATAGAGAAGAAGG + Intergenic
1038133993 8:24766329-24766351 GAGGGGAGACATATTAAAGATGG - Intergenic
1038851802 8:31285991-31286013 GAGAGAAGACATTCTCAAGAGGG + Intergenic
1040046193 8:42966354-42966376 CATGGGAGACATACTCAAGAAGG + Intronic
1040604562 8:48918846-48918868 CAGGAGAGACATTCTGGAGAAGG + Exonic
1040979928 8:53236426-53236448 CTGGGAAGGCATTGTGAAGACGG + Intronic
1041090984 8:54300364-54300386 CAGGGGAGACATCCGGGAGGCGG + Intergenic
1042376028 8:68054089-68054111 CAGGGGAAAACATCTGAAGATGG - Intronic
1044510412 8:93070925-93070947 CAGAAGAGCCCTTCTGAAGAAGG - Intergenic
1044541984 8:93418668-93418690 CAGGGGTGATTTTCTGAAGAAGG - Intergenic
1044861208 8:96525592-96525614 GAGGGTAGACAAGCTGAAGAAGG - Intronic
1045398492 8:101785911-101785933 CAGAAGAGACATTCTGCAGCTGG - Intronic
1046381995 8:113463530-113463552 CAGGGAAAACATTCTGGAGAAGG + Intergenic
1046568768 8:115935587-115935609 CAGGGGACAATTTCAGAAGAGGG + Intergenic
1046935634 8:119882979-119883001 CACGGGGGACATCGTGAAGATGG + Intronic
1047599855 8:126415042-126415064 AAGGGGAAACATTCTCAGGAAGG + Intergenic
1049004458 8:139845938-139845960 TGGAGGAGACACTCTGAAGAGGG + Intronic
1049478309 8:142807076-142807098 AAGGGGAGCCATCCTGAAGCAGG - Intergenic
1050756802 9:9014665-9014687 CATGGGAGACAATCTGAGGAAGG + Intronic
1051802163 9:20947545-20947567 CAAGGGAAAGATTCTGGAGATGG + Intronic
1055425463 9:76191277-76191299 AAGGGGAAACATTCAAAAGAAGG - Intronic
1057633985 9:96746082-96746104 CAGAGAAGACAGTGTGAAGACGG + Intergenic
1057962866 9:99473699-99473721 CAGGACAGACATTCTGAAGATGG - Intergenic
1058823026 9:108749843-108749865 CATGGGAAACATAGTGAAGATGG - Intergenic
1059432271 9:114257371-114257393 CGGGGGAGACATTAGGCAGAGGG + Intronic
1060777675 9:126388132-126388154 CAGGGGTGATATCCTGAAAATGG - Intronic
1061508318 9:131045329-131045351 CAGGGGAGGCTGTCTGAAGCAGG + Intronic
1061534225 9:131237673-131237695 CATAGGAGACATTTTGAAAACGG - Intergenic
1185525693 X:777041-777063 CTGGGAAGACAGTCTCAAGATGG + Intergenic
1185875968 X:3702657-3702679 CAGGGAAGACATTGTATAGAAGG + Intronic
1190370648 X:49737348-49737370 CAGGGCAGACTTCCTGAAGGAGG - Intergenic
1190783591 X:53622215-53622237 CAGGGTGGACATTCTCAACAGGG - Intronic
1193540043 X:82759952-82759974 CAGGGAAGGCTTTCTGAAGGAGG - Intergenic
1198423857 X:136496277-136496299 CAGGGGAGACAGAATTAAGATGG - Intergenic
1199685802 X:150264104-150264126 CCGGGGATGCATGCTGAAGATGG + Intergenic
1199780050 X:151050183-151050205 CAGGGAAGAGATTGTGCAGAAGG + Intergenic
1200068219 X:153515076-153515098 CAGGGGAGAAAATCTGAGGCAGG - Intergenic
1200180969 X:154150500-154150522 GAGGGGAGACTGTCTGAGGATGG + Intronic
1200186612 X:154187614-154187636 GAGGGGAGACTGTCTGAGGATGG + Intergenic
1200192264 X:154224752-154224774 GAGGGGAGACTGTCTGAGGATGG + Intronic
1200198019 X:154262556-154262578 GAGGGGAGACTGTCTGAGGATGG + Intronic
1200789612 Y:7287768-7287790 CAGGGAAGACATTGTATAGAAGG - Intergenic
1200986432 Y:9306541-9306563 CAGGTGAGGCATCCTGGAGAGGG - Intergenic
1202124147 Y:21554361-21554383 CAGGTGAGGCATCCTGGAGAGGG + Intergenic
1202154861 Y:21875019-21875041 CAGGTGAGGCATCCTGGAGAGGG - Intergenic