ID: 978598557

View in Genome Browser
Species Human (GRCh38)
Location 4:110404245-110404267
Sequence ACTTATACGCAGACTTTTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978598557_978598561 23 Left 978598557 4:110404245-110404267 CCGTCAAAAGTCTGCGTATAAGT 0: 1
1: 0
2: 0
3: 8
4: 94
Right 978598561 4:110404291-110404313 ATTAGTAGCCTGCTGTTGACTGG 0: 1
1: 7
2: 51
3: 237
4: 470

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978598557 Original CRISPR ACTTATACGCAGACTTTTGA CGG (reversed) Intronic
900875093 1:5336796-5336818 AGTTATAAGGAAACTTTTGAAGG - Intergenic
904706527 1:32394939-32394961 ACTTAGATGCAGCCTTTGGAGGG + Intergenic
908029231 1:59982224-59982246 ACTTACACTCTGACTTTTGAAGG - Intergenic
908743785 1:67355802-67355824 AGTTGTTAGCAGACTTTTGAAGG + Intronic
910293869 1:85625056-85625078 AGCTATACACAGACTTTTTATGG - Intergenic
915739929 1:158111417-158111439 CCTTGTACTCACACTTTTGAGGG + Intergenic
916371831 1:164106154-164106176 ACATATATCCAGATTTTTGAAGG + Intergenic
924143596 1:241050955-241050977 ATTTATTTGCAGATTTTTGATGG + Intronic
924785298 1:247191350-247191372 ACATATGCCCATACTTTTGATGG + Intergenic
1064394185 10:14967685-14967707 AGTTATACACAAATTTTTGACGG - Intronic
1065755940 10:28931175-28931197 ACTTATTTGCAGAGTCTTGATGG + Intergenic
1068786584 10:60982387-60982409 AATTATACTAAGATTTTTGAGGG + Intronic
1073813073 10:107172375-107172397 ATTTATCCACAGACTTTTAAAGG + Intergenic
1078309332 11:10223296-10223318 AGTTATGTGCAGATTTTTGACGG - Intronic
1083022318 11:59519602-59519624 ACTTATTCCCAAACTTTTCATGG + Intergenic
1084775395 11:71371488-71371510 ACTTAGACGCAGCCATTTGGGGG + Intergenic
1087065840 11:94027198-94027220 ACTTATAAGGATGCTTTTGATGG + Intronic
1087422152 11:97943110-97943132 ATTTCTAAGCAGAGTTTTGAAGG + Intergenic
1088604712 11:111517237-111517259 ATTTATATCCAGACTTTTTAGGG + Intronic
1095989158 12:48022333-48022355 ATTTATATGTAGACTTATGAAGG + Intronic
1098773194 12:74581072-74581094 AGTTATAAGCAGATTTTTAAAGG - Intergenic
1105616166 13:22014801-22014823 ACTTAGACTCAGACTTGTGACGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1107817707 13:44258943-44258965 ACTTACATCCAGACTTTTTAAGG + Intergenic
1114333376 14:21660588-21660610 ACTAATTCGAAGACTTTCGATGG - Intergenic
1116008360 14:39322197-39322219 TCTTGTAGGCAGATTTTTGATGG + Intronic
1116591574 14:46782417-46782439 ACTTATAAGCTTACTTTGGAAGG - Intergenic
1117198798 14:53366776-53366798 ACTGAGACGCTGACTTTGGAGGG + Intergenic
1117604856 14:57417904-57417926 ACTTTTACTCAGCCTTTAGATGG + Intergenic
1117673735 14:58134438-58134460 ACTTATAAGTAGTCTGTTGAAGG - Intronic
1121130789 14:91444959-91444981 TCCTATACGCAGTTTTTTGAGGG - Intergenic
1123809939 15:23914338-23914360 ACTTATAACCATCCTTTTGATGG - Intergenic
1127368942 15:58318103-58318125 AGTTTTATGCAGAATTTTGACGG + Intronic
1130175429 15:81564345-81564367 ATTTACACTCAGTCTTTTGACGG + Intergenic
1135692568 16:24554311-24554333 AAAAATAGGCAGACTTTTGAGGG + Intronic
1137873762 16:51975567-51975589 GCTTATACACAGACATGTGAAGG - Intergenic
1146190403 17:30760585-30760607 CCATATACACAGACTTATGATGG - Intergenic
1146335570 17:31967237-31967259 CCATATACACAGACTTATGATGG - Intronic
1155555339 18:27012213-27012235 AGTTATACTCAGATTTTTGATGG - Intronic
1159245679 18:65801515-65801537 ATGTATATGCACACTTTTGATGG + Intronic
927482228 2:23463302-23463324 TATTATAAACAGACTTTTGAAGG - Intronic
933066040 2:77797620-77797642 ACATAAATGCAGAATTTTGAGGG - Intergenic
937278811 2:120703537-120703559 ACTCATGAGCAGAGTTTTGAAGG - Intergenic
938014117 2:127853143-127853165 ATTTAGAAGCAAACTTTTGAAGG - Intronic
939656907 2:144837238-144837260 TCTTTTAGGCAGATTTTTGAAGG - Intergenic
941672150 2:168305821-168305843 ATCTATACTCAGATTTTTGAGGG + Intergenic
942189318 2:173455330-173455352 ACTTCAACACAGAATTTTGAGGG + Intergenic
943009946 2:182435103-182435125 ACTTATAGGAAGTTTTTTGATGG - Intronic
945557743 2:211300277-211300299 ACTTATACGGTGCCTGTTGATGG - Intergenic
1170394305 20:15909372-15909394 ACTTAGACCCTGCCTTTTGAAGG + Intronic
1170702678 20:18717390-18717412 ACTTATACACAGACTGTACATGG - Intronic
1170835688 20:19883005-19883027 AGTTGTACTCAGATTTTTGACGG + Intergenic
1172496431 20:35388685-35388707 AACTCTACTCAGACTTTTGAAGG - Intronic
1177265755 21:18781271-18781293 AGTTATATGCATATTTTTGATGG + Intergenic
1178050585 21:28742520-28742542 ACTTATCCAAAGACTTTTCAAGG + Intergenic
951723128 3:25723073-25723095 TTTTATACCCACACTTTTGAGGG - Intronic
957398840 3:79681759-79681781 ACTTACAAGTAGACTTTTGTAGG + Intronic
957535913 3:81503329-81503351 CCATATATGAAGACTTTTGAAGG + Intronic
960755790 3:121010593-121010615 AGTTGTACACAGGCTTTTGACGG - Intronic
960946720 3:122971947-122971969 ACTTCTTCACAGACTTGTGAAGG + Intronic
965199932 3:165645053-165645075 ACTTATGCACATAATTTTGAGGG + Intergenic
967564234 3:190954861-190954883 GCTTGTACCCAGACTTTGGAAGG - Intergenic
970671562 4:18402325-18402347 CCTGATATGCAGGCTTTTGAGGG + Intergenic
973307267 4:48666879-48666901 TCTTTTACTTAGACTTTTGATGG - Intronic
976843336 4:89457736-89457758 ACTAATAAGATGACTTTTGATGG - Intergenic
977535598 4:98253272-98253294 AGTTATATAGAGACTTTTGATGG - Intergenic
978598557 4:110404245-110404267 ACTTATACGCAGACTTTTGACGG - Intronic
979795190 4:124837742-124837764 ACTGATACGCAGACTATGTAAGG - Intergenic
982508823 4:156254276-156254298 ACCTATAGGAAGAATTTTGAGGG + Intergenic
982926108 4:161338692-161338714 AGTTATAAGCAGATTTTTAAAGG + Intergenic
985150741 4:186944788-186944810 ACATTTACGCAGAATTTTGAAGG + Intergenic
986254559 5:6091407-6091429 ACTTATACAAATACTTATGAGGG - Intergenic
990107606 5:52284037-52284059 ACTTGGAGTCAGACTTTTGAGGG + Intergenic
995967021 5:117919844-117919866 AAATATACTCAGAGTTTTGATGG - Intergenic
998695988 5:144640199-144640221 ACTTTTAAGCAGAGATTTGAAGG + Intergenic
1005515028 6:26546124-26546146 ACTTTTACGGTGACTTTTGGAGG + Exonic
1009331920 6:62433455-62433477 ACTTATATGAAGTCTTTTTAAGG + Intergenic
1009705602 6:67246689-67246711 AATTATATGCAAATTTTTGAAGG + Intergenic
1011643480 6:89435516-89435538 ACTTAAAAGCAGGCTATTGAGGG + Intronic
1012012417 6:93806176-93806198 AGTTATACGCAAATTTTTGATGG + Intergenic
1013317779 6:108958378-108958400 ACTTATTAGCTGACTTTTGAGGG + Intronic
1013362669 6:109409180-109409202 AACTATACCCAGTCTTTTGAGGG - Intronic
1016728166 6:147399653-147399675 ACTGATACAGAGACTTTTAAAGG - Intergenic
1017856613 6:158355383-158355405 GCCTATAAGCAGAGTTTTGAAGG + Intronic
1020543681 7:9494348-9494370 ACTGTTAGGCAAACTTTTGAGGG + Intergenic
1020579365 7:9975674-9975696 ACTTAAAGGCAGAATATTGAAGG - Intergenic
1024976797 7:55120845-55120867 GCTTATAGGAAGACATTTGATGG + Intronic
1030749598 7:113214962-113214984 ACATATATACAGTCTTTTGAAGG + Intergenic
1030805087 7:113907442-113907464 ACTGAAACTCAGACTTTTCAAGG - Intronic
1036530709 8:9583837-9583859 AATTATAAGCATACTTTTCATGG + Intronic
1038239399 8:25794626-25794648 AGTTATAGACAGACTTTTAATGG - Intergenic
1039012519 8:33110366-33110388 ACTAAAACGCAGAGTATTGAGGG - Intergenic
1040927162 8:52696541-52696563 ACTTGTACTCATTCTTTTGATGG - Intronic
1041209883 8:55538494-55538516 AATTATACATAGACCTTTGAAGG - Exonic
1046956196 8:120065145-120065167 ACTCATACACACACATTTGAAGG + Intronic
1057904045 9:98970910-98970932 ACTCATACACATACTTTCGAAGG - Intronic
1186728741 X:12385008-12385030 ACTTTTAGGCAGACTTCGGATGG + Intronic
1187561854 X:20410874-20410896 ACTTGTAAGCTGAGTTTTGAAGG + Intergenic
1189925533 X:45949896-45949918 ACTTATATGCTGAATTTTGAGGG - Intergenic
1193015581 X:76729646-76729668 ATTTATTTGCACACTTTTGAAGG - Intergenic
1198719557 X:139601447-139601469 AATTATACTCAGAATTTTGAAGG - Intronic
1202027391 Y:20539061-20539083 ACTTCTACTCACTCTTTTGATGG - Intergenic
1202047608 Y:20750291-20750313 ACTGAAATGCACACTTTTGAAGG + Intergenic