ID: 978609293

View in Genome Browser
Species Human (GRCh38)
Location 4:110519639-110519661
Sequence TTGAATAATAATGATGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 911
Summary {0: 1, 1: 2, 2: 16, 3: 98, 4: 794}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978609293 Original CRISPR TTGAATAATAATGATGATGA TGG (reversed) Intronic
900718436 1:4159866-4159888 TGCAATAATAATGATGGAGAAGG + Intergenic
900923686 1:5689845-5689867 TTGTATAATAATTAGGTTGAAGG + Intergenic
902957087 1:19933085-19933107 TAGGATAATGATGATGATGGTGG - Intergenic
903292116 1:22320859-22320881 ATAAATAATAATGATGACAATGG + Intergenic
904434955 1:30488737-30488759 GTTGATAGTAATGATGATGATGG + Intergenic
904876057 1:33655325-33655347 TAAAAGAATAATGATGATAATGG + Intronic
905627915 1:39500530-39500552 TTTGATAGTGATGATGATGATGG + Intronic
906439382 1:45827642-45827664 AAAAATAATGATGATGATGATGG - Intronic
906711974 1:47937510-47937532 TGTAATAATGATGATGATGGTGG - Intronic
906711975 1:47937513-47937535 ATTTGTAATAATGATGATGATGG - Intronic
906906298 1:49897064-49897086 TTGAATAATACTGATGAAAGTGG - Intronic
907102323 1:51848106-51848128 TTGAATAGTAGTGACGATAAAGG - Intronic
907560968 1:55387109-55387131 CATAATAATATTGATGATGATGG - Intergenic
907593925 1:55702520-55702542 TTACATAATAATGATGATGTAGG + Intergenic
907779332 1:57551398-57551420 GTGCATGATAATAATGATGATGG + Intronic
908279323 1:62514647-62514669 AATAATAATAATAATGATGATGG + Intronic
908431913 1:64066938-64066960 TTGTATAATAATTATTATAATGG + Intronic
908620963 1:65979022-65979044 TTGAAGAAAGATGAAGATGATGG - Intronic
908823758 1:68114418-68114440 ATCTATAATGATGATGATGATGG + Intronic
909308252 1:74110630-74110652 TTGAATAATAATGGTAATAATGG - Intronic
909356914 1:74719909-74719931 TGGCATCATAATGATGTTGATGG + Intronic
909385198 1:75047039-75047061 TTGAATAACAGTGATGACAATGG - Intergenic
909721246 1:78772388-78772410 TTGAATTATAATGATGTTACTGG - Intergenic
909858900 1:80578080-80578102 TTGAATGATGATGATGTTAATGG + Intergenic
909977780 1:82065472-82065494 TTGAGTAGCAAAGATGATGATGG + Intergenic
910270350 1:85387404-85387426 TTTAATAGTGATGATGATGAAGG - Intronic
910302793 1:85726049-85726071 TTTAATGATGATGATGATGATGG + Intergenic
910381818 1:86634369-86634391 TTGAATAACAATGGATATGATGG + Intergenic
910384803 1:86670172-86670194 TTGAATAATAGTGATGAAAATGG - Intergenic
910539461 1:88339278-88339300 CTGAATAATAATCATGATTATGG + Intergenic
910792455 1:91065252-91065274 ATGAATAATTTTGATTATGAGGG + Intergenic
910895051 1:92060373-92060395 CTGCATCATGATGATGATGATGG + Intronic
910972992 1:92875356-92875378 TTGAATAGTAATGATTTGGAGGG - Intronic
911211815 1:95148086-95148108 TTTCATAATAATGATAAAGAGGG + Intronic
911228648 1:95335765-95335787 AAGAATAATATTGATAATGATGG + Intergenic
911487560 1:98521164-98521186 TTGAATAATAGTGGTGAAGGGGG - Intergenic
911821776 1:102432934-102432956 TTGAAAAAAAATGATGGAGAAGG - Intergenic
912128659 1:106573042-106573064 TTGTTTAAGGATGATGATGATGG - Intergenic
912164651 1:107028858-107028880 GTGAAGAATAATAATGAAGAAGG + Intergenic
912190710 1:107336935-107336957 TTGAATAGTAATCATTCTGACGG - Intronic
912558720 1:110535023-110535045 AAGAATAATAATGATGATGGTGG - Intergenic
912558721 1:110535026-110535048 ATAAAGAATAATAATGATGATGG - Intergenic
913536447 1:119777555-119777577 TTGAAAAATAAGAATAATGAGGG + Intergenic
913590956 1:120324156-120324178 TTAAATAATAATTATCAGGATGG - Intergenic
913682424 1:121199018-121199040 TATAATAATGATGATGATGATGG + Intronic
914034263 1:143986647-143986669 TATAATAATGATGATGATGATGG + Intergenic
914155183 1:145081323-145081345 TATAATAATGATGGTGATGATGG - Intronic
914599857 1:149193786-149193808 TTAAATAATAATTATCAGGATGG + Intergenic
914642588 1:149625078-149625100 TTAAATAATAATTATCAGGATGG + Intergenic
914736296 1:150420472-150420494 ATCAATAGTAATGATAATGAAGG - Intronic
914869793 1:151463416-151463438 TTGAACCATCTTGATGATGATGG + Intergenic
915710043 1:157887522-157887544 TTGAATAAGAATGATTAGGGTGG - Intronic
915731007 1:158054392-158054414 TTAAATAATAGTAATGATGATGG - Intronic
915753260 1:158232893-158232915 TTGAATAACAGTGATGAAAATGG - Intergenic
915999057 1:160596992-160597014 TATAATAATAATAATAATGAAGG + Intergenic
916502371 1:165397845-165397867 ATGAATAATAATAATAATAATGG + Intergenic
916506136 1:165429520-165429542 TTCCATAATAATGATGGGGAAGG + Intronic
916647339 1:166798646-166798668 TTAAATAATAATCATGGTGAGGG - Intergenic
918443599 1:184594226-184594248 TTGAAAAATGATGATCATGAAGG + Intronic
919003461 1:191864808-191864830 TTGAATAACAATGGTGAAGGTGG - Intergenic
919101532 1:193103051-193103073 TTAAATAATAATAATAATAATGG + Intronic
919127019 1:193407530-193407552 TCCAAAAATGATGATGATGATGG - Intergenic
919246286 1:194989615-194989637 TGGAATAAAAAAGTTGATGAGGG - Intergenic
919303854 1:195804790-195804812 CTGAAAAATAATGATGTTTATGG - Intergenic
919671930 1:200346138-200346160 ATGAATAAGAATGATGCTGCTGG - Intergenic
920469736 1:206217536-206217558 TATAATAATGATGATGATGATGG + Intronic
920588489 1:207193288-207193310 TTAAAAAATAGTGATGATTAAGG + Intergenic
920603176 1:207349896-207349918 TTGAATAGGAATGATAATAATGG + Intronic
920752891 1:208698000-208698022 TTGAAAAATACTGATGACTATGG - Intergenic
920943885 1:210510319-210510341 TTGAATGAGAATGATGGTGTTGG + Intronic
921542417 1:216432365-216432387 TTTAATTATACTGATAATGATGG - Intergenic
921569899 1:216765292-216765314 AACAATAATAATGATGATAATGG + Intronic
921740982 1:218684492-218684514 GGTAATAATAATGATGTTGAGGG + Intergenic
921952791 1:220949015-220949037 TTAAATAGAAATGATGATAAGGG + Intergenic
922474102 1:225894944-225894966 TTCAATAAAAGTGATGATAATGG + Intronic
923202953 1:231729905-231729927 TTAAAAAATAATGATGATGGTGG + Intronic
924192935 1:241574306-241574328 TTGAATAAAAGTGATGAAAATGG + Intronic
924486369 1:244487529-244487551 TGGCATAATGATGGTGATGATGG - Intronic
924533432 1:244913291-244913313 TTGAATAATGGTGGCGATGAGGG + Intergenic
924792391 1:247264427-247264449 TTGAATAACAGTGATGAAAATGG + Intergenic
924842667 1:247729976-247729998 TTAAAAAATAATGATAATGAAGG - Intergenic
924850123 1:247820257-247820279 TTCAAAAATATTGAAGATGAAGG - Intergenic
924910381 1:248505700-248505722 TTGTAAAATAATAAAGATGATGG - Intergenic
924913719 1:248542339-248542361 TTGTAAAATAATAAAGATGATGG + Intergenic
1063449138 10:6139857-6139879 CTAAACAATAATGATGATAATGG + Intergenic
1063449141 10:6139937-6139959 TATAATAATGATGATGATAATGG + Intergenic
1063704300 10:8415955-8415977 TTGAATAATGATGAAAATAAAGG + Intergenic
1064039123 10:11943140-11943162 TCTGATAATGATGATGATGAGGG - Exonic
1064591244 10:16892968-16892990 TTTAATAATAATGATGATAATGG + Intronic
1065509724 10:26466401-26466423 TGTAATGATAATGATGGTGATGG - Intronic
1065742481 10:28809592-28809614 TTAAAGAATAAGGATGCTGAGGG + Intergenic
1065826612 10:29578304-29578326 TTAAATACAAATGAAGATGAAGG + Intronic
1065951016 10:30651161-30651183 TTAAATACAAATGAAGATGAAGG - Intergenic
1066561336 10:36672969-36672991 TTCTATACTAATGCTGATGATGG + Intergenic
1067023725 10:42825804-42825826 TTGAATAAAAGTGATGAAGCTGG + Intronic
1067481244 10:46599309-46599331 TTGAATACAAGTGATGATAATGG + Intergenic
1067613507 10:47742422-47742444 TTGAATACAAGTGATGATAATGG - Intergenic
1068067828 10:52154043-52154065 TTGAATAAAAATAAAAATGAAGG - Intronic
1068341467 10:55709761-55709783 AGGAATAATAATGATTATGTAGG + Intergenic
1068716978 10:60199329-60199351 TGGAAGAATAAGGAGGATGAGGG + Intronic
1068785724 10:60971065-60971087 ATCAATAATGATAATGATGATGG - Intronic
1068815551 10:61306621-61306643 TTGAATAGAAATAATGATGGTGG + Intergenic
1068839604 10:61595684-61595706 TGTAATATTTATGATGATGATGG - Intergenic
1069265689 10:66454760-66454782 TAGTATAAAAATGAAGATGAAGG + Intronic
1069433000 10:68354119-68354141 ATTAATAATAATGATGATGATGG - Intronic
1070475672 10:76826844-76826866 TTGATTAATAGTGATGTTAATGG + Intergenic
1071090021 10:81907420-81907442 GTGGATGATGATGATGATGATGG + Intronic
1071323898 10:84492505-84492527 TTGAATAAGAATTATGAGAATGG + Intronic
1071574846 10:86717659-86717681 TGCAATAATGATGATGCTGATGG - Intronic
1071628915 10:87202515-87202537 TTGAATACAAGTGATGATAATGG - Intergenic
1071821001 10:89280749-89280771 TGGAATAATAACGAGGAAGAAGG - Intronic
1072380383 10:94862945-94862967 TTGAATAACAATGATGACAGTGG - Intergenic
1072392669 10:95004053-95004075 TTGAATAACAATGATGACAGTGG - Intergenic
1072709848 10:97709043-97709065 TACAATAAAAATGATGATGGTGG - Intergenic
1073922666 10:108477412-108477434 TTTGATGATAATGATGATGGTGG - Intergenic
1073965191 10:108980738-108980760 TTGTAAAAAAATGATAATGAAGG + Intergenic
1074605318 10:114957966-114957988 TTAGAAAATAAAGATGATGATGG + Intronic
1075632569 10:124010088-124010110 TTGTAAAATCCTGATGATGACGG + Exonic
1075990166 10:126830369-126830391 TTGAATAATAGTGATGAAAGTGG - Intergenic
1076227704 10:128793487-128793509 TTGAATAGTAAAGATTATGGGGG - Intergenic
1077397922 11:2334742-2334764 TTGAAAAAGAAGGATGATAAGGG - Intergenic
1079362581 11:19781509-19781531 ATTGAGAATAATGATGATGAGGG + Intronic
1079519290 11:21306451-21306473 AAGTATAATAATAATGATGATGG + Intronic
1079587343 11:22142294-22142316 TGAAATGATGATGATGATGAGGG - Intergenic
1080105313 11:28505640-28505662 TAGAATAATAAACTTGATGAGGG + Intergenic
1080111338 11:28571363-28571385 TAGAAAAATAATAATAATGAAGG + Intergenic
1080148491 11:29019795-29019817 TTTAATAATAATGACGATGATGG + Intergenic
1081001526 11:37679205-37679227 TTAAATAATGGTGTTGATGATGG + Intergenic
1081513008 11:43795356-43795378 TTGAATAAGAATTATAATGGAGG - Intronic
1082019527 11:47520360-47520382 TTCAAAAGAAATGATGATGAAGG - Intronic
1082071389 11:47942557-47942579 TTCTATAAAAATGATGATTATGG + Intergenic
1082930856 11:58603605-58603627 TTAAAGAAGAATGATGCTGAGGG + Intronic
1084449604 11:69228223-69228245 TGGAATAATGATGATGAGGATGG + Intergenic
1085416656 11:76322852-76322874 GTGAATAATAATGATGGTGGTGG - Intergenic
1085590326 11:77754028-77754050 TTGAATAATAATTATGACTCTGG + Intronic
1085653960 11:78295390-78295412 TTGAATAATGAATATGATCAGGG - Intronic
1085746244 11:79117025-79117047 GATAATAATGATGATGATGATGG - Intronic
1085793114 11:79513179-79513201 CTGGATGATAATGATGATGACGG - Intergenic
1085957892 11:81422444-81422466 AATAATAATGATGATGATGATGG - Intergenic
1086173927 11:83867534-83867556 TGGAACAATAATGATGATAGTGG + Intronic
1086253278 11:84843489-84843511 AGGAATAATGATGATGATGATGG - Intronic
1086264621 11:84983026-84983048 TTGAATAAAAAGGATGAGGGTGG - Intronic
1086447723 11:86885970-86885992 GTTAATGATGATGATGATGATGG + Intronic
1086583618 11:88427174-88427196 ATAAACAATAATGATGGTGATGG - Intergenic
1086846721 11:91759139-91759161 TTGGATAATAATACTGATTATGG - Intergenic
1087260215 11:96002665-96002687 ATGAAGAATAATGATGGGGATGG + Intronic
1087289602 11:96305532-96305554 TTGAATAATAATAATGAGACAGG + Intronic
1087320729 11:96655111-96655133 GTCAGTAGTAATGATGATGATGG + Intergenic
1087371042 11:97284256-97284278 TTGAATAATAATGGTGAAAGTGG - Intergenic
1087388678 11:97506691-97506713 TGGACTAATAATAATGATTAAGG + Intergenic
1087707854 11:101515134-101515156 TTGAATAATTATGATTAAGAAGG - Intronic
1087814877 11:102647697-102647719 AACAATAATAATGAAGATGATGG - Intergenic
1087886246 11:103486440-103486462 ATGACCAATAATAATGATGATGG + Intergenic
1088002718 11:104901717-104901739 TGGAAGAAGAATCATGATGAGGG - Intergenic
1088422475 11:109664530-109664552 TTGGATAATTATAATGATAAGGG - Intergenic
1088677421 11:112208463-112208485 TTGAATATAAGTGATGATAATGG + Intronic
1088697256 11:112378677-112378699 TTGAATAAATAAGTTGATGATGG + Intergenic
1089611985 11:119674357-119674379 ATTAATAATAATGATGATGATGG + Intronic
1089639142 11:119835731-119835753 TTGAAGAATAATGAGCCTGATGG + Intergenic
1091133557 11:133167229-133167251 AATAATAATGATGATGATGAGGG - Intronic
1091179055 11:133587046-133587068 GATAATGATAATGATGATGATGG + Intergenic
1092047357 12:5441442-5441464 TTTAATATCATTGATGATGATGG - Intronic
1092485003 12:8895398-8895420 TTGATTACTAATGAGGTTGAGGG + Intergenic
1092551566 12:9507698-9507720 GAGAATATGAATGATGATGATGG - Intergenic
1092613154 12:10192553-10192575 GAGAACAATAATGATGGTGATGG - Intergenic
1092942486 12:13423262-13423284 ATGAATGATATTGATGATCATGG + Intergenic
1093162184 12:15760904-15760926 TTGAATAATAATGGTGAAAGTGG - Intronic
1093887390 12:24478025-24478047 TTGAATTATATTGATTTTGAGGG - Intergenic
1093933535 12:24977792-24977814 GTGAAAAATAATAATGATGTAGG - Intergenic
1094105328 12:26805356-26805378 ATTAATAATGATGATAATGATGG - Intronic
1094380339 12:29835961-29835983 TTGAATAACAGTGGTGAAGATGG + Intergenic
1094395606 12:30002258-30002280 GAGGACAATAATGATGATGATGG + Intergenic
1094461158 12:30697469-30697491 TTTAATAAAGATGATGATGTGGG + Intergenic
1095354776 12:41258873-41258895 ATGAGTAGTGATGATGATGATGG + Intronic
1097146638 12:56944270-56944292 TTGAATAATAGTAGTGATGGTGG + Intergenic
1097580244 12:61446973-61446995 TTGCACAATATTGTTGATGATGG - Intergenic
1097602026 12:61704844-61704866 TTGCATAAGAATCATGTTGATGG - Intergenic
1097629861 12:62047373-62047395 TTGAATCATTATGATGATCCTGG - Intronic
1098089153 12:66882659-66882681 TTGAAATAAAACGATGATGATGG - Intergenic
1098596328 12:72275974-72275996 TCTAATAATAATAATGAGGAAGG - Intronic
1098763506 12:74454827-74454849 TATAATGATAATGATGACGATGG + Intergenic
1098810935 12:75090793-75090815 TCAAATGATGATGATGATGATGG - Intronic
1098968662 12:76824407-76824429 TTTAAAAATTATGATGATTAGGG + Intronic
1098998648 12:77150743-77150765 ATGATTGATAATGATGATGGTGG - Intergenic
1099093818 12:78347101-78347123 TTGAATAAAAGTGATGAAAATGG - Intergenic
1099348420 12:81533037-81533059 TTGTATCATAATGTTGGTGAGGG + Intronic
1099435584 12:82641201-82641223 TTGAATAAAAATGATGAAAGTGG - Intergenic
1099660577 12:85554244-85554266 ATGAAAAATGATGACGATGATGG + Intergenic
1099775032 12:87115171-87115193 TTGACTAATAATAGTTATGAAGG - Intergenic
1099870555 12:88343809-88343831 AATAATAATGATGATGATGATGG + Intergenic
1100042056 12:90331752-90331774 CTAATTAATAATAATGATGAAGG - Intergenic
1100249861 12:92807969-92807991 TTGAAAAATAATAAAGGTGAAGG + Intronic
1100349459 12:93765320-93765342 AGTAATAATAATAATGATGATGG + Intronic
1100370570 12:93965489-93965511 GTGAACAATGATGATGATGATGG - Intergenic
1100648939 12:96563382-96563404 TTGAATAAGAATGCTAATGTAGG - Intronic
1100761972 12:97817666-97817688 TTAAATAATAATAATGAACAAGG + Intergenic
1101246822 12:102891506-102891528 TATAATAATAATGATGATAATGG + Intronic
1101253341 12:102956003-102956025 TGGAACAATAGTGATGATGGTGG - Intronic
1101319100 12:103657331-103657353 TTTAATAATAATAATAATAAAGG + Intronic
1102241609 12:111328061-111328083 AACAATAATAATAATGATGAGGG + Intronic
1102485762 12:113255001-113255023 CTGAATAAAAATGATGAGAAGGG - Intronic
1102669591 12:114606311-114606333 ATTAATAATGATGATAATGATGG - Intergenic
1102960489 12:117090237-117090259 TAGAATAATAATGAATATGTAGG + Intronic
1103464971 12:121134798-121134820 CTGATTGATAATGATGATGAAGG + Intronic
1103673631 12:122638782-122638804 TAGAATAATAAAAATAATGATGG - Intergenic
1104214057 12:126718483-126718505 TTGTATGGTGATGATGATGATGG + Intergenic
1104351875 12:128051262-128051284 AAGAATAATAATGAAGAAGAGGG + Intergenic
1104649606 12:130522237-130522259 GTGAATTCTAATGAGGATGAGGG + Intronic
1105754788 13:23454244-23454266 TAGAATAATAAGGCTGAGGAAGG - Intergenic
1105936339 13:25103329-25103351 TTGAATAGAAATGTTGATCATGG - Intergenic
1106014974 13:25860335-25860357 ATAAATAATAATAATGAGGAAGG - Intronic
1106279166 13:28248460-28248482 TTGAATAAAAGTGATGAAAATGG + Intronic
1107171453 13:37347111-37347133 TTCAATAGTTCTGATGATGATGG + Intergenic
1107540934 13:41388522-41388544 AAGAATAATAACAATGATGATGG - Intergenic
1107657611 13:42607689-42607711 TTGAATAATAAGCAGGATGTTGG + Exonic
1108251895 13:48575993-48576015 GGTGATAATAATGATGATGATGG + Intergenic
1108604995 13:52028883-52028905 TTGAGTGAAAATGAAGATGAGGG + Exonic
1108718130 13:53102602-53102624 TTGAATAATAATCAGGATTGTGG - Intergenic
1108822143 13:54365527-54365549 TTGAATAAGAATGATTATATAGG - Intergenic
1108975015 13:56430511-56430533 TTAAAGAATAATGATGTTGAAGG + Intergenic
1109233863 13:59791975-59791997 TTGTCTAAGAATGATGGTGATGG - Intronic
1109748022 13:66652106-66652128 TTGAATAACAGTGATGAAGATGG - Intronic
1109932854 13:69238782-69238804 ATGAATAATAATGTTGAGTAAGG + Intergenic
1110077786 13:71270970-71270992 TTGAATAATAATGATAATAGTGG + Intergenic
1110160060 13:72366092-72366114 ATGAATAATAATTGAGATGAAGG - Intergenic
1111920538 13:94405695-94405717 ATGAATCATATTGATAATGAAGG - Exonic
1112074808 13:95900589-95900611 TTTAATGAGAATGATGATGTGGG - Intronic
1112674736 13:101687763-101687785 TTGGATGATATTGATGATGTTGG + Intronic
1112946433 13:104933035-104933057 TTGAATAAAAATTATGAAGAGGG - Intergenic
1113078458 13:106491781-106491803 TTTAATAACAACGATGATGATGG + Exonic
1113872649 13:113570278-113570300 TTGAAGAACAATAATGTTGAAGG - Intergenic
1115301168 14:31887126-31887148 GTTAATAATAATGATGAGAATGG + Intergenic
1115329504 14:32180561-32180583 TTGAATAATAGTGGTGAAAATGG + Intergenic
1115942450 14:38624342-38624364 TTGAATAAAAGTGATGAGAATGG - Intergenic
1116027185 14:39528967-39528989 TTGAATAACAGTGGTGATGCTGG + Intergenic
1116062824 14:39945658-39945680 TTGAATAACACTGATGAAAAGGG + Intergenic
1116197731 14:41751169-41751191 TTGAATTATAATTGTGTTGAGGG - Intronic
1116348628 14:43829601-43829623 TTGAATATGAATGGTGAAGAAGG + Intergenic
1116612701 14:47097389-47097411 TGGAATAATAAGCATGATTAAGG + Intronic
1116992410 14:51290289-51290311 GATAATGATAATGATGATGATGG + Intergenic
1117247726 14:53902321-53902343 TGGAATAAGAATGATGATCCTGG - Intergenic
1117260337 14:54026226-54026248 TTAAATAATAATAATAATAATGG + Intergenic
1118655811 14:67947148-67947170 TTTATTAATGATGATGATAATGG - Intronic
1119042050 14:71283535-71283557 GTGAATAGAAATGATGAAGATGG + Intergenic
1119099154 14:71864046-71864068 TTCAAAAATAGTGAAGATGATGG - Intergenic
1119380783 14:74226931-74226953 TTGTATAATAATAATAATAAAGG + Intergenic
1119577955 14:75744998-75745020 TAGAAAAATAATGATGTTGAGGG + Intronic
1120038808 14:79729078-79729100 TTAGATAATAATAATGATGGTGG - Intronic
1120417254 14:84235109-84235131 TTTAATAGTAATGATGATGAAGG - Intergenic
1120587945 14:86338965-86338987 TTGAATAAAAGTGATGAAAATGG + Intergenic
1120599459 14:86483540-86483562 TTGAATAAGAATGTTGATAGAGG - Intergenic
1121840996 14:97133612-97133634 AATAGTAATAATGATGATGATGG - Intergenic
1121950366 14:98166353-98166375 TTGGATTATAATGATGAGTAGGG - Intergenic
1123217166 14:106821648-106821670 TTGAATAATAATTTTGATGTGGG + Intergenic
1123424871 15:20162839-20162861 TTGAATAAAAGTGATGAGGCTGG + Intergenic
1123479971 15:20622238-20622260 TTGATAAACAATTATGATGAGGG + Intergenic
1123534095 15:21169370-21169392 TTGAATAAAAGTGATGAGGCTGG + Intergenic
1123638036 15:22378126-22378148 TTGATAAACAATTATGATGAGGG - Intergenic
1124123751 15:26915939-26915961 TTTTATGGTAATGATGATGATGG - Intronic
1124667108 15:31602557-31602579 TTGAATAGGAATGGTGAAGAGGG - Intronic
1124795117 15:32770879-32770901 TTGAATCCTTATGTTGATGATGG - Exonic
1125260626 15:37820810-37820832 TTTAATAATAATAATAATGATGG - Intergenic
1125396316 15:39251970-39251992 TTGAATAATAACTATGATTCTGG - Exonic
1126233821 15:46358447-46358469 TTGAATAATAATGGTGAGAGAGG - Intergenic
1126242858 15:46465680-46465702 AAGAATCACAATGATGATGAGGG + Intergenic
1126807591 15:52367422-52367444 TTGAAGGATAAGGATGGTGATGG + Intronic
1126911165 15:53418689-53418711 TTAAATAATAATAATAATAAAGG + Intergenic
1127146171 15:56026356-56026378 TTGAATAAGAATAGTGATGGTGG + Intergenic
1127176117 15:56359787-56359809 TTAAATAATAATGATGATAAAGG + Intronic
1127547219 15:60003002-60003024 TTTGATGATGATGATGATGACGG + Intergenic
1127628316 15:60801850-60801872 TAAAATGATAATGATGATGATGG + Intronic
1127858252 15:62970561-62970583 TTGAATAATAATGGAGATAGTGG + Intergenic
1128090107 15:64913391-64913413 AGGAATAATAGTGATGATGATGG + Intronic
1128192919 15:65720860-65720882 TTAAATAATACTGATAATTAAGG - Intronic
1128411165 15:67399381-67399403 TATCATAATAATGATGATAATGG - Intronic
1128679781 15:69640816-69640838 TTGAATAAGAGTGGTGAGGATGG + Intergenic
1129946411 15:79542719-79542741 TACAATCATAATGATGAAGATGG - Intergenic
1130087525 15:80790406-80790428 CTGAATATTAATGATGCTGATGG - Intronic
1130637306 15:85636428-85636450 TTGAATAAAAGTGATGAGAATGG + Intronic
1131586954 15:93705495-93705517 GATAATGATAATGATGATGAAGG + Intergenic
1131910460 15:97194222-97194244 ATGAATAAGAATAATGATGAGGG + Intergenic
1131933864 15:97479369-97479391 TTGAATAAGAATGGTGAGAATGG + Intergenic
1132323550 15:100945791-100945813 TTGATTAATAAAGAATATGAAGG - Intronic
1132458911 16:39823-39845 AATAATAATAATAATGATGATGG - Intergenic
1133535064 16:6693802-6693824 GTGGAGAATGATGATGATGATGG - Intronic
1134039707 16:11059328-11059350 TTAAGTTATAATGATGATGATGG - Intronic
1134469026 16:14505686-14505708 ATAAATAATAATCATGATGTAGG + Intronic
1134474148 16:14556874-14556896 TTAAATGATAATAATGATGTGGG - Intronic
1134819202 16:17232553-17232575 TTGATTGATGATGATGAAGATGG + Intronic
1135404375 16:22187691-22187713 TCTCATAATAATGATGATGCAGG + Intronic
1135467475 16:22699594-22699616 CTTAGTAATTATGATGATGATGG + Intergenic
1136129954 16:28213391-28213413 TTGAATAGGAATGATGAGAAAGG + Intergenic
1137465526 16:48705348-48705370 TAGATTGATAATGATAATGATGG - Intergenic
1137623247 16:49890812-49890834 AGTAATAATAATGATGAAGATGG + Intergenic
1137680228 16:50336247-50336269 TTTATTTATAATGATGTTGATGG - Intronic
1137917431 16:52448053-52448075 TTAAAAAATAATAATGATTAGGG - Intronic
1138185834 16:54976954-54976976 ATGAATAACAATGTTGATAATGG + Intergenic
1138369390 16:56513752-56513774 TTGAAAATTGATGATGGTGATGG + Intronic
1138821526 16:60265966-60265988 TAGGATAATAATGATGAACATGG - Intergenic
1138847429 16:60583579-60583601 ATGAAGAATCAAGATGATGAAGG + Intergenic
1139052607 16:63144717-63144739 GTGTAGGATAATGATGATGATGG - Intergenic
1139089069 16:63621509-63621531 TTTATTAATAAAGATAATGATGG - Intergenic
1139094371 16:63686402-63686424 AATAATAATAATAATGATGATGG + Intergenic
1139361335 16:66402014-66402036 TTAATAATTAATGATGATGATGG + Intronic
1140036506 16:71375556-71375578 ATAAATAAGAATGATGATGGTGG + Intronic
1141140710 16:81495190-81495212 TACAGTAATGATGATGATGATGG - Intronic
1141185902 16:81787035-81787057 TTAATTAATAATGATGTTGGCGG + Intronic
1141224762 16:82104602-82104624 ATTGATGATAATGATGATGATGG - Intergenic
1143239556 17:5432307-5432329 TTGAAGACTATTGATGCTGATGG + Intronic
1143411055 17:6709115-6709137 TTTCATTATAATGTTGATGAGGG - Intronic
1143789129 17:9279385-9279407 TTCATTAATAATAATGATGATGG - Intronic
1143913347 17:10270542-10270564 TTGACTCATAATGATGGTGGAGG + Intergenic
1144179293 17:12736951-12736973 ATAAAGAATAATGATGATTATGG + Intronic
1145841290 17:27996965-27996987 TTTAATGATAATGATGATGGTGG + Intergenic
1146099932 17:29971395-29971417 TTAAATAATAATGGTGATATGGG + Intronic
1146390875 17:32421822-32421844 GTTAAAAATAAAGATGATGAGGG - Intergenic
1147546219 17:41403841-41403863 TTCTATGACAATGATGATGATGG + Intergenic
1149156383 17:53634882-53634904 TTAAATGAAAATGAAGATGAAGG - Intergenic
1149217642 17:54376453-54376475 ATGAATTATAATGATGAAGGTGG + Intergenic
1149352714 17:55807995-55808017 TTTAATAATGATGATAATGATGG + Intronic
1149628693 17:58100948-58100970 TTGAAAAATAATGATAAAGTTGG - Intergenic
1149700604 17:58652098-58652120 TTCATTAATAATGAAGATTAGGG + Intronic
1150581588 17:66478833-66478855 TTTAACAATAATCATGATGTGGG - Intronic
1150719644 17:67603351-67603373 TTGACTCATAATAATGGTGATGG + Intronic
1150813227 17:68373211-68373233 TTGAAAAATAAAAATGATCATGG - Intronic
1150850072 17:68695951-68695973 TGTAATGATAATGGTGATGATGG - Intergenic
1151321596 17:73355931-73355953 TATCATAATGATGATGATGACGG + Intronic
1151374714 17:73679283-73679305 TTGAATAATCAAACTGATGAAGG - Intergenic
1153267034 18:3281501-3281523 TAGAAAAATGATGAAGATGATGG + Intergenic
1153552654 18:6278136-6278158 ATGAATATTAATGATGATAGTGG + Intronic
1155223439 18:23706525-23706547 TTGATCACTAATGATGGTGATGG + Intronic
1155944716 18:31835464-31835486 TTGAATAGTACTGAAGATTATGG - Intronic
1156686842 18:39660186-39660208 TAAAATAATAATGATGAGAATGG + Intergenic
1156795583 18:41041839-41041861 GTTAATAATAATGATGATGGCGG + Intergenic
1157035388 18:43966521-43966543 ATAAATAATAATGATGATAGTGG - Intergenic
1157832761 18:50872168-50872190 TTCAATGATGATGATGATGATGG + Intergenic
1157902687 18:51535199-51535221 TTGAAGAAAAATGAAGCTGAAGG - Intergenic
1158224341 18:55185008-55185030 ATGAATAATAAAGTTGATGAAGG + Intergenic
1158363981 18:56709424-56709446 TTACATAATAATAATAATGATGG + Intronic
1158420444 18:57288319-57288341 TAGAGTGATAATGAAGATGATGG - Intergenic
1158499131 18:57984186-57984208 ATTAAAAATGATGATGATGATGG - Intergenic
1159311278 18:66713887-66713909 TTGGATAAAAATGTAGATGAAGG + Intergenic
1159408651 18:68040441-68040463 TGCAATAATAGTGATCATGAAGG - Intergenic
1159426420 18:68294139-68294161 TTGAAAAAAAATGATGATAATGG - Intergenic
1159818264 18:73105231-73105253 TTCAAAAATAATAATAATGATGG + Intergenic
1160247173 18:77168282-77168304 CTCAATAATAATGATAATGACGG + Intergenic
1160993311 19:1870280-1870302 CTGAATAATAATAATGACAATGG + Intergenic
1161873505 19:6889273-6889295 GATAATAATGATGATGATGATGG + Intronic
1161904223 19:7143122-7143144 TTTAAAAAAAATGATGGTGATGG - Intronic
1162184399 19:8893747-8893769 AATAATAATGATGATGATGACGG - Intronic
1162285969 19:9739171-9739193 GTGTATAATAAACATGATGATGG + Intergenic
1162701666 19:12520159-12520181 TTGTCTAATAATTCTGATGAGGG - Intronic
1163297647 19:16422487-16422509 TTGAATTATCTAGATGATGAGGG + Intronic
1164721460 19:30434753-30434775 ATTGATGATAATGATGATGATGG + Intronic
1164721470 19:30434834-30434856 GGTAATGATAATGATGATGATGG + Intronic
1165082900 19:33320367-33320389 TTTGATGATGATGATGATGATGG - Intergenic
1165235050 19:34414156-34414178 TTAAATAATAATAATAATAAAGG - Intronic
1165910880 19:39226291-39226313 TTGAATAAGAATGGTGATAGAGG - Intergenic
1166674166 19:44729414-44729436 TATAAAAATATTGATGATGATGG + Intergenic
1167881668 19:52464184-52464206 TTGAATAATAATCACCATTAGGG + Intronic
1167913019 19:52719627-52719649 TGGAACAGTAATGAAGATGAAGG - Intronic
1168410571 19:56137510-56137532 TTGAAACATAGTGATGAAGAAGG + Intronic
925283449 2:2700974-2700996 TCTAATAATAATGATGATCATGG + Intergenic
926181497 2:10648214-10648236 TTGAAGCATAATCATGATTATGG - Intronic
926453297 2:13034034-13034056 TTAAATAATAAATATTATGATGG - Intergenic
926971984 2:18475671-18475693 TTGTATGATGATGATGATGGTGG + Intergenic
926974247 2:18497320-18497342 TTGATTTCTAAAGATGATGAGGG + Intergenic
926994362 2:18717935-18717957 TTTGATGATGATGATGATGATGG + Intergenic
927433935 2:23051065-23051087 TAGAAAGACAATGATGATGATGG + Intergenic
927535378 2:23853197-23853219 TTAAATAGTAATGGTGATAATGG - Intronic
928360677 2:30659886-30659908 TTTGCTAATAATGATGATGGAGG - Intergenic
928971658 2:37036020-37036042 TTGAATAATATTTAGGATGAAGG - Intronic
929220495 2:39459868-39459890 CTGTATAATGATTATGATGATGG + Intergenic
929407087 2:41655136-41655158 GATAATAGTAATGATGATGATGG + Intergenic
929527216 2:42716103-42716125 TTGAATAATAGTGAAGATACAGG - Intronic
929708002 2:44236093-44236115 TTGAAAAAAAATTATAATGAAGG + Intronic
929801826 2:45111042-45111064 TATAATGATGATGATGATGAAGG - Intergenic
930370802 2:50498916-50498938 TTCATTAATAATGTGGATGATGG - Intronic
930540054 2:52694257-52694279 CTGAATAATTATCATGTTGATGG - Intergenic
930548891 2:52806174-52806196 TTGAAAAATATTAATGATTAAGG + Intergenic
930905644 2:56563254-56563276 TTTAAAAATAATAAAGATGATGG - Intergenic
931174235 2:59836858-59836880 TTGAAGAAGAATACTGATGAAGG - Intergenic
931493237 2:62772716-62772738 ATGAACAGTCATGATGATGATGG - Intronic
932015862 2:68025439-68025461 TTGAATAACAATGGTGAAAATGG + Intergenic
932378292 2:71258112-71258134 TAGAATAATGATGATGATGATGG - Intergenic
933386790 2:81621039-81621061 TTTATTAATACTGATGAGGAAGG + Intergenic
933665696 2:84963123-84963145 CTGAGCAATAATGATGCTGAAGG - Intergenic
934458347 2:94194014-94194036 TTGAATAAAAGTGATGAGGCTGG - Intergenic
934944272 2:98526478-98526500 TTTAAAAATAAGAATGATGAGGG + Intronic
934993760 2:98938944-98938966 ATGATTAGCAATGATGATGATGG - Intergenic
935074415 2:99726979-99727001 TGTAATAGTAATAATGATGATGG - Intronic
935870296 2:107440887-107440909 TGCAAAAATAATGATGGTGATGG + Intergenic
936705691 2:115070985-115071007 TTGAATATTAATATTTATGAAGG + Intronic
936884081 2:117288217-117288239 TTGAATAAAAATGATGAAAGTGG - Intergenic
937109948 2:119357686-119357708 TTGAATAAGAATGGTGAGAATGG - Intronic
937229312 2:120388316-120388338 TTGAAGGATAATGAGGAGGAAGG + Intergenic
938312841 2:130304833-130304855 TACAATAATGATGATGATGTTGG + Intergenic
939327188 2:140708187-140708209 TTGAACAATGATAATGTTGAAGG + Intronic
939392059 2:141581050-141581072 TTGAAAACTGATGATGATCATGG + Intronic
939412793 2:141852308-141852330 TTGAATAATATTCATTTTGAAGG - Intronic
939461105 2:142495911-142495933 TTGAGTATTAATTATTATGAGGG - Intergenic
939496294 2:142931829-142931851 TTGAATAATTTGGCTGATGAAGG + Intronic
939650839 2:144759793-144759815 TAGAGTAATAGTGGTGATGATGG - Intergenic
939964312 2:148595502-148595524 ATGCATGATGATGATGATGACGG + Intergenic
940857525 2:158741113-158741135 TTTAATGATAATGATAATGAGGG - Intergenic
940967834 2:159859909-159859931 AAGAATAATAAGGATGGTGATGG - Intronic
940988679 2:160075640-160075662 TGGAATAATAATGATAGTGCTGG + Intergenic
941407117 2:165103920-165103942 TTAAATAATAATGTTGTTGATGG - Intronic
941458973 2:165744597-165744619 GGGAAGAATAATGATGATAATGG + Intergenic
941666969 2:168251768-168251790 AGGAATAATGATGATGATGGTGG - Intergenic
941677244 2:168356859-168356881 TTTAATAAAAATGATGCTGAAGG - Intergenic
942544599 2:177050086-177050108 ATTAATAAGGATGATGATGATGG + Intergenic
942809304 2:179978222-179978244 TTGAATAATAATACTTATGTTGG + Exonic
943046014 2:182863367-182863389 ATGAATAATAATGGTCAGGATGG + Intronic
943476015 2:188356141-188356163 TTGAATAAAAGTGATGAAAACGG - Intronic
943529390 2:189060068-189060090 ATGAATGATGATAATGATGAAGG - Intronic
943998986 2:194808348-194808370 TTGGAGGATAATGATGATTATGG - Intergenic
944400847 2:199324457-199324479 TAGCATAATGATGATAATGATGG - Intronic
944584149 2:201158845-201158867 AATAATAATAATAATGATGAGGG - Intronic
944687037 2:202126598-202126620 CTCAGTAAAAATGATGATGATGG + Intronic
944895392 2:204158850-204158872 TTGAACAATAATGAGGGAGATGG - Intergenic
945077289 2:206052491-206052513 TCAAATAAAAATGATGATGAAGG - Intronic
945503590 2:210609518-210609540 TTTAATAATAACAATAATGATGG - Intronic
945711707 2:213305393-213305415 TTGAATAATAGTGGTGACGATGG + Intronic
945713792 2:213332972-213332994 TTGAATAATAGTGGTGACAATGG - Intronic
946900088 2:224364044-224364066 TAGAATAATAATGATCATGATGG - Intergenic
947322504 2:228937772-228937794 TAGAATCATAAAAATGATGAAGG + Intronic
947924185 2:233906665-233906687 GAATATAATAATGATGATGATGG + Intergenic
948215475 2:236226237-236226259 TTCAATATCAATGATGATAATGG - Intronic
948240918 2:236433789-236433811 GTAAATAATAGTGGTGATGATGG + Intronic
1168967682 20:1909082-1909104 GTGAATAACAATAATGATGAGGG + Intronic
1169861438 20:10157060-10157082 TTAACTGATAATAATGATGATGG - Intergenic
1169975024 20:11315307-11315329 TTTTATAATAATAATGGTGATGG - Intergenic
1169994001 20:11536122-11536144 TTGAGTAATAATTATCATCATGG + Intergenic
1170267505 20:14484109-14484131 TAGAATAATACTGATGATTTAGG + Intronic
1171258702 20:23711656-23711678 GGTGATAATAATGATGATGATGG - Intergenic
1171878111 20:30597354-30597376 ATGAATAATGATGGTGCTGAAGG - Intergenic
1172348875 20:34225484-34225506 TTGAAAAAGAAGGATGATAAGGG - Intronic
1172940788 20:38652986-38653008 TTGGATAATAGTGATCATGATGG + Intergenic
1174310492 20:49649734-49649756 CTGAGTAATAATTAGGATGAGGG - Intronic
1174356036 20:49998450-49998472 GCAAATAATAATGACGATGATGG + Intergenic
1174755531 20:53154874-53154896 GTCAATAATGATAATGATGATGG - Intronic
1175431127 20:58903969-58903991 TTTAATAATAATAATCATTAGGG + Intronic
1175574091 20:60047493-60047515 TATGATAATAATAATGATGATGG + Intergenic
1176814955 21:13590744-13590766 TTGAATAAGAATGGTGAGAAAGG - Intergenic
1177215954 21:18129141-18129163 TTTAATGATAAAAATGATGATGG + Intronic
1177242775 21:18481345-18481367 CTGAATAATAATAATGCTGTGGG - Intronic
1177311610 21:19402279-19402301 TTGAAAAATTATGATCAAGACGG - Intergenic
1177392386 21:20493155-20493177 TTTAATAACAATGATGAGAATGG + Intergenic
1177581184 21:23023142-23023164 AGAAATGATAATGATGATGATGG - Intergenic
1177967204 21:27742919-27742941 TTGAATAATAGTGATGAAAGTGG + Intergenic
1178372126 21:32035122-32035144 TTTATTAATAATGCTGATGTTGG - Intronic
1178634959 21:34294371-34294393 ATGATTTATAATGATGGTGATGG + Intergenic
1178967043 21:37130571-37130593 TCTAATAATAATGAAAATGATGG - Intronic
1179424412 21:41263010-41263032 TTGAATACAAATGGTGATAATGG + Intronic
1179817829 21:43918965-43918987 TTAAGTAATAACGATGGTGATGG - Intronic
1180748430 22:18108424-18108446 TGGGATAAAGATGATGATGATGG - Intronic
1181357864 22:22312412-22312434 TTGAATAAAAGTGATGAGGCTGG + Intergenic
1182111286 22:27725533-27725555 TTTAATGATGATGATGGTGATGG - Intergenic
1182708995 22:32308643-32308665 TTGAATCTTTCTGATGATGAGGG + Intergenic
1183007419 22:34915032-34915054 TTGAATAATTCTGATGAAGAAGG - Intergenic
1183099707 22:35576364-35576386 TTTTATAATAATGAGGAAGAAGG + Intergenic
1183367689 22:37415967-37415989 AAAAATAATAATAATGATGATGG + Intronic
1183367690 22:37415970-37415992 AATAATAATAATGATGATGGTGG + Intronic
1183924182 22:41193991-41194013 TTAGATGATGATGATGATGATGG + Intergenic
1183944119 22:41314586-41314608 AAAAATAATAATGATGATTATGG - Intronic
1184050515 22:42000512-42000534 TTCTATGATGATGATGATGATGG - Intronic
1184436337 22:44480024-44480046 TAGCATAATGATGATGATGATGG - Intergenic
1185209580 22:49562711-49562733 TGGAATAATAGTGGAGATGACGG - Intronic
949782247 3:7702775-7702797 TTGAATAATTAGGAAGAGGATGG + Intronic
949783945 3:7719934-7719956 TTTGATAATAATTATGATGGTGG + Intronic
949902357 3:8827427-8827449 TTGAATAGAAATGATGATCAGGG - Intronic
949929445 3:9067150-9067172 AGGGATAATAATGATGATGATGG - Intronic
950113750 3:10437271-10437293 AGTAATAATAATAATGATGATGG + Intronic
950813190 3:15670439-15670461 TTGAATGTTAAGGATGATAAAGG + Exonic
951005240 3:17608292-17608314 TTGAGTAAAAGTGATGATAATGG - Intronic
951102159 3:18701985-18702007 ATAAATAATAAAGATGATAAAGG - Intergenic
951284984 3:20799817-20799839 TTGAATAAGAATGATGACAGTGG + Intergenic
951333843 3:21397866-21397888 AACAATGATAATGATGATGATGG - Intergenic
951426122 3:22547005-22547027 TTAAAGAACAATGGTGATGATGG + Intergenic
951915989 3:27801311-27801333 TAGAATAGTGAAGATGATGATGG + Intergenic
951918340 3:27825474-27825496 CTGGATAATAATAATGATAATGG + Intergenic
952040420 3:29255023-29255045 TTTAATATTCGTGATGATGATGG + Intergenic
952499601 3:33948295-33948317 GTTAATAATAATCATGATGAGGG - Intergenic
952776187 3:37048690-37048712 TGGAATGATAAAGATGATAAGGG + Intronic
952857410 3:37783636-37783658 TTGAATAATAATAATAATCTTGG - Intronic
953028871 3:39163142-39163164 TTAAATGATAATGATCATGATGG + Intergenic
953050908 3:39342472-39342494 TTTAAGAATAATGGTGATGCTGG + Intergenic
953087862 3:39690032-39690054 AGTAATGATAATGATGATGACGG + Intergenic
953631807 3:44624559-44624581 TTAAATAATAATCAAGTTGATGG - Intronic
955179640 3:56655232-56655254 TTGAATAAAAATGGTGATTTTGG - Intronic
955548957 3:60062334-60062356 TTCAATGATAATGACAATGAGGG + Intronic
955746449 3:62145373-62145395 AGTAACAATAATGATGATGATGG - Intronic
956059186 3:65332660-65332682 ATGGACAATAATGATGGTGATGG - Intergenic
956234118 3:67048548-67048570 TTGAAAAATTATCATAATGAGGG - Intergenic
956262514 3:67360393-67360415 TTGAAGAGTTATGAGGATGAAGG - Intergenic
956715590 3:72076990-72077012 TTAAATAATAATAATAATAATGG - Intergenic
956882997 3:73530007-73530029 GCTAATAATGATGATGATGATGG - Intronic
957430047 3:80092745-80092767 TAAAATAAAAATGATCATGATGG - Intergenic
957977247 3:87462020-87462042 TTGAACAATTATGTTGTTGAGGG - Intergenic
959384086 3:105679916-105679938 TTGAATAAATATGATAATGTAGG - Intronic
959437082 3:106329068-106329090 TTGAATACTGGTAATGATGATGG - Intergenic
960628176 3:119701787-119701809 ATAAATAATAATGATCATAACGG + Intergenic
962591282 3:136891722-136891744 TTTAATAATAACCATGGTGATGG + Intronic
962689045 3:137874812-137874834 TTGAATAATGGTGATGATAATGG - Intergenic
962693144 3:137921341-137921363 TTTGATGATGATGATGATGATGG + Intergenic
963012440 3:140784910-140784932 TTGAATAAAAGTGATGATAGTGG - Intergenic
963826663 3:149962720-149962742 TTTAATAATAATTATTTTGAAGG - Intronic
964045431 3:152318892-152318914 TTGAATAATCATAATAATCAGGG - Intronic
964207812 3:154194170-154194192 TCTAATAATAATGATTATAATGG + Intronic
964272560 3:154973587-154973609 TTCAATAAAAAACATGATGAGGG - Intergenic
964367190 3:155962771-155962793 TTAGATAATGATGATTATGAAGG + Intergenic
964847373 3:161058424-161058446 TTTAGTAATAATGAAAATGATGG - Intronic
964904677 3:161705744-161705766 CTGAATAATTACGATGATGGAGG + Intergenic
965032844 3:163395631-163395653 TTGAATAAAAATGATGAAACTGG - Intergenic
965092883 3:164183971-164183993 ATGAATAATAAAGATAATGGGGG - Intergenic
965144763 3:164887485-164887507 TTGAATAACAGTGATGAAAATGG + Intergenic
965273288 3:166647077-166647099 TTTAATAATAATAATAATAAAGG + Intergenic
965800028 3:172482710-172482732 TTGAATAAAAGTGATGAAAATGG + Intergenic
965912991 3:173804505-173804527 TTTAATAATAATGTTGAAGGGGG - Intronic
966019035 3:175184024-175184046 TTGAACAATAATACTTATGATGG - Intronic
966077937 3:175961317-175961339 TTCAATAATAATTATGCTTAGGG - Intergenic
966561945 3:181331145-181331167 TCTAAAAATAATGATAATGAAGG - Intergenic
966648446 3:182272293-182272315 GTGAATATTAATACTGATGATGG + Intergenic
967764736 3:193266578-193266600 TCCACTAATAATGGTGATGATGG - Intronic
968300499 3:197609360-197609382 TTGAATAACAGTGATGAAAATGG - Intergenic
969806390 4:9612217-9612239 AATAATAATAATAATGATGATGG + Intergenic
969923502 4:10562786-10562808 TTGAAAAATAATGATAATGCAGG - Intronic
970173941 4:13318388-13318410 TTGAATAAGAGTGTTGATGTGGG + Intergenic
970188392 4:13485817-13485839 TCTAATTATGATGATGATGAGGG - Intergenic
970227533 4:13875270-13875292 TGCAATGATAATGATGTTGATGG - Intergenic
970497392 4:16640497-16640519 CTGAGAAATAATGATGAAGAAGG - Intronic
970498961 4:16657330-16657352 CAGGGTAATAATGATGATGATGG - Intronic
970932750 4:21531742-21531764 TGAAATAATAATGATGACAATGG + Intronic
971515048 4:27475046-27475068 GTGAGGAATAGTGATGATGAGGG - Intergenic
971890514 4:32514642-32514664 TTTAATAATTGTGATAATGAAGG + Intergenic
972619133 4:40730025-40730047 TTGAATAAAAAAGAAGAAGAGGG + Intergenic
972691940 4:41407529-41407551 TTGAAGGATAAAGATGATGGGGG - Intronic
972868466 4:43265200-43265222 ATTATTAATAATAATGATGATGG + Intergenic
973123113 4:46547605-46547627 TTGGATAATAATGGTGATGATGG - Intergenic
974364167 4:60924820-60924842 TTGAATGATAATAATAATAATGG + Intergenic
974466941 4:62269984-62270006 GTTAACAATGATGATGATGATGG - Intergenic
974714360 4:65647756-65647778 TTGTATAATTATGATTAAGATGG + Intronic
974816970 4:67017677-67017699 TTGAATAATGATGATGATGATGG - Intergenic
974863010 4:67546009-67546031 ATGTATAATAATGGTGATGATGG + Intergenic
974886724 4:67827946-67827968 TTAAATAGTAGTGATGATAAGGG + Intronic
974915023 4:68169119-68169141 TTGAATATAAATGACCATGAAGG - Intergenic
975593395 4:76022765-76022787 TTGATTACTAATGCTGATGCAGG + Exonic
975941161 4:79648407-79648429 TTTAACAATTATAATGATGATGG + Intergenic
976070873 4:81238195-81238217 TTGAATAAATATTATGGTGAGGG - Intergenic
976267671 4:83200210-83200232 TTAAATAATAATGATGGTGCAGG - Intergenic
976323506 4:83744531-83744553 TTGAATAACAGTGGTGATGGTGG - Intergenic
976483629 4:85574242-85574264 TTTCATAATAAGGATAATGATGG - Intronic
976489073 4:85646312-85646334 TTCCTTTATAATGATGATGATGG - Intronic
976879584 4:89903391-89903413 TTGAACATAAATGATGATGATGG + Intronic
977386336 4:96344389-96344411 TAAAATAATAATGACAATGATGG + Intergenic
977760373 4:100728447-100728469 CTGAATAATATTGATGTTGATGG - Intronic
977981239 4:103325007-103325029 TTGAATACAAAGGAAGATGAAGG - Intergenic
978010116 4:103670851-103670873 TTGAATAAAAATGGTGAAAATGG + Intronic
978196039 4:105973172-105973194 GTGAATGTTAATGAAGATGAAGG - Intronic
978543167 4:109840927-109840949 AATAATAATAATGATGATGGTGG - Intronic
978543168 4:109840930-109840952 GCAAATAATAATAATGATGATGG - Intronic
978609293 4:110519639-110519661 TTGAATAATAATGATGATGATGG - Intronic
978801489 4:112759727-112759749 TTGATTAATAATGATTATTATGG + Intergenic
979012684 4:115391359-115391381 TTGAATAGGAATGATGAGGGAGG - Intergenic
979014155 4:115411257-115411279 TTAAATAATAATATTTATGATGG + Intergenic
979903906 4:126259462-126259484 GATAATAATGATGATGATGATGG - Intergenic
980289378 4:130825824-130825846 TTGAGTAATGCTGATTATGATGG - Intergenic
980496709 4:133594274-133594296 TTTTATAATAGTGATGATAATGG + Intergenic
980853315 4:138410307-138410329 TTGAATAATCAGAATAATGATGG + Intergenic
981189331 4:141842286-141842308 TTGAAAAATCTTGATGATCAGGG + Intergenic
981233157 4:142382881-142382903 TTGAATAATAATGATGATAGTGG + Intronic
981419814 4:144536422-144536444 ATGAATAATAATAATGATTATGG - Intergenic
981453731 4:144929637-144929659 TTGAATAAGAGTGGTGAAGAGGG + Intergenic
981689498 4:147491546-147491568 TCAAATTAAAATGATGATGAAGG + Intronic
982716243 4:158811551-158811573 TTAATTAATAATAATAATGATGG + Intronic
983139338 4:164129202-164129224 TTGTAGAATAATGATTAAGAAGG + Intronic
983355222 4:166648279-166648301 TTGAATAAGAGTGATGAGAAGGG + Intergenic
983758896 4:171380011-171380033 CTGAATAATATCCATGATGAAGG + Intergenic
984627817 4:182027508-182027530 TTGAATAACAGTGATGAAAATGG + Intergenic
984895465 4:184535705-184535727 TTGAATAATGATGATGATGATGG + Intergenic
985221320 4:187708389-187708411 TTGAATAAAAATGATGAAAGTGG - Intergenic
985224225 4:187742673-187742695 TTGAATAGTAGTGATGACGGTGG - Intergenic
986279118 5:6308671-6308693 TTTAACAACAGTGATGATGATGG + Intergenic
986384138 5:7215120-7215142 TAGGATGATAATGATGTTGATGG - Intergenic
986887601 5:12258885-12258907 TTAAATAATAATAAAGATGATGG + Intergenic
987140090 5:14937009-14937031 TTGAATAGCAATGGTGAAGATGG + Intergenic
987152074 5:15052597-15052619 TTGAATAGTAATGATGAGAGTGG + Intergenic
987430241 5:17824181-17824203 TTGAATAAGAGTGATGAGGGAGG - Intergenic
987437778 5:17917897-17917919 TTGCATAATAATAATAATTAAGG + Intergenic
987518037 5:18940336-18940358 GTGAAAAATATTGATAATGAAGG + Intergenic
987700635 5:21393556-21393578 AATAATAATAATGATAATGAAGG + Intergenic
987717074 5:21585885-21585907 TGGAAGAATAATGATGTGGAAGG + Intergenic
987778744 5:22404027-22404049 TTGAACAAAATTGAGGATGAAGG + Intronic
987940729 5:24532250-24532272 CTGAATAATAATAATAATAATGG + Intronic
988295813 5:29361003-29361025 TTGAATAATATATATGAAGAAGG + Intergenic
988440405 5:31226844-31226866 TTGCATAATAATGAGGATAGTGG - Intronic
988705478 5:33722328-33722350 TTTAATATCAATAATGATGATGG + Intronic
988953461 5:36289918-36289940 TTGAATAGAAGTGATGATAATGG + Intronic
989182308 5:38590624-38590646 ATGAATTTTGATGATGATGATGG - Intronic
989342625 5:40393223-40393245 CTGTACACTAATGATGATGAAGG - Intergenic
989789014 5:45369598-45369620 CTGAAGAATATTGATGATGCAGG - Intronic
990842821 5:60103256-60103278 TTCAAAACAAATGATGATGATGG + Intronic
991224488 5:64254137-64254159 TTGAAAAATCAAGATTATGAAGG + Intronic
991551571 5:67842714-67842736 TGCTATCATAATGATGATGATGG - Intergenic
993262337 5:85674603-85674625 TAGAACAATAATGATGTTTAAGG - Intergenic
993530368 5:89017256-89017278 TACAATAACAATAATGATGATGG - Intergenic
993835206 5:92811545-92811567 TGGAATAATAATAATAATAATGG - Intergenic
993964236 5:94341431-94341453 CTCCATGATAATGATGATGATGG - Intronic
994361221 5:98850757-98850779 TTAAAAAATAATAATGAAGAAGG + Intergenic
994410542 5:99402636-99402658 TTGAACTATAACAATGATGACGG + Intergenic
994483284 5:100362633-100362655 TTGAACTATAACAATGATGACGG - Intergenic
995070001 5:107909483-107909505 TTGAACAACAATGAGAATGATGG + Intronic
995229400 5:109741722-109741744 TTGAATAATAATGCTGCTGGGGG - Intronic
995662759 5:114503779-114503801 TTGAACAGTAGTGATGATGCTGG - Intergenic
995776841 5:115732611-115732633 TTGCATAATAATGATGATATTGG + Intergenic
995892566 5:116971738-116971760 TTTAAAAATAATAATAATGATGG - Intergenic
996258275 5:121432817-121432839 TTGAATAATAGTGGTGAAGGTGG - Intergenic
996463517 5:123773533-123773555 TTGAATGATAATAAGGATGGAGG + Intergenic
996903440 5:128571197-128571219 GTGATTAATGATGATGATAATGG - Intronic
997221740 5:132172935-132172957 TTGAAAAAGAATGAAGTTGAAGG + Intergenic
997285015 5:132671930-132671952 TTTAATAATAATAATAATAAGGG + Intergenic
997364158 5:133314819-133314841 AATAATAAAAATGATGATGATGG + Intronic
997677491 5:135724146-135724168 TAGAAAAATGATCATGATGATGG - Intergenic
997740000 5:136244971-136244993 ATAAATAGTAATGATGATAATGG - Intronic
998418702 5:141964437-141964459 AGGAATGATGATGATGATGATGG + Intronic
998557021 5:143135381-143135403 AGTTATAATAATGATGATGATGG - Intronic
998595449 5:143525012-143525034 TTTAAGGATAATGATAATGATGG + Intergenic
998760408 5:145425962-145425984 AATAATAATAATGATGATGAGGG - Intergenic
999215762 5:149933623-149933645 TTGAAAAATAGGGATGATTATGG - Intronic
999517209 5:152313527-152313549 TGTATTAATAATGATTATGATGG - Intergenic
999649568 5:153752043-153752065 TTGATTAACAATGATGATGATGG - Intronic
999725277 5:154431591-154431613 ATGATTAAGAATGATGATGGGGG - Intergenic
999848916 5:155516232-155516254 ATCAATAATAATGATAATAATGG + Intergenic
1000395263 5:160768157-160768179 TTTAAAATTCATGATGATGATGG - Intronic
1000498878 5:162022180-162022202 TTGAATAACAATGATGACACTGG - Intergenic
1000550099 5:162651071-162651093 TATAATAATTATGATTATGATGG - Intergenic
1000908339 5:166990561-166990583 TGAAATATTAATGATAATGATGG + Intergenic
1000983655 5:167843749-167843771 TATAATAATAATGATGATAAAGG + Intronic
1001231430 5:169991980-169992002 TTTATTAATAATGACAATGATGG - Intronic
1001270624 5:170308815-170308837 TATAATAATGGTGATGATGATGG + Intergenic
1001298648 5:170517480-170517502 GGCAATAATGATGATGATGATGG + Intronic
1001528017 5:172442699-172442721 ATAAATGATGATGATGATGATGG + Intronic
1001634278 5:173198546-173198568 GATAATAATAATGATGATAATGG + Intergenic
1002943100 6:1734850-1734872 TCAAATAATAATAATGATAATGG + Intronic
1003005555 6:2377832-2377854 ATAATTAATAATGATGATGATGG + Intergenic
1003012719 6:2441001-2441023 TGAAATAATAATAATAATGAGGG - Intergenic
1003022193 6:2519652-2519674 TTAAATCATAGTGATGATAAAGG + Intergenic
1003197630 6:3929027-3929049 ATGAAAATTTATGATGATGAGGG + Intergenic
1003240252 6:4338843-4338865 TTTAATGATAATGATGAACAAGG - Intergenic
1003287975 6:4751553-4751575 TTTAATGATAATAATGAAGAGGG + Intronic
1003302391 6:4895994-4896016 TTGGAGAAAAATGATGGTGAGGG - Intronic
1003356448 6:5377525-5377547 TTAAATAATAATAATAATAATGG - Intronic
1003682976 6:8274112-8274134 TTAAATTATAATGCTGATAAAGG - Intergenic
1004090754 6:12498240-12498262 ATAAATAATAATAATGAGGAAGG + Intergenic
1004185391 6:13416991-13417013 TATGATAAGAATGATGATGATGG - Intronic
1004550928 6:16646487-16646509 TTTAATGATAATGATGATAACGG - Intronic
1004580620 6:16947610-16947632 TTCATTAATAATGGTGATGCTGG - Intergenic
1004862435 6:19818852-19818874 TTGAATAATAGTGATTGTTAAGG + Intergenic
1005033239 6:21531079-21531101 TTGAATATTAATGGTTAAGAGGG - Intergenic
1005177811 6:23067864-23067886 TTGGATAAAAATGGTGTTGAGGG + Intergenic
1005183371 6:23133713-23133735 TGCAATAAAAATGATGGTGAAGG + Intergenic
1005523075 6:26617466-26617488 TTGAATAAGAGTGATGATAGTGG - Intergenic
1005764769 6:29000182-29000204 TAGAAAAATAATGAAGAGGAAGG - Intronic
1006217374 6:32455965-32455987 TTGAATAAGAATGGTGAGGGAGG - Intergenic
1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG + Intergenic
1006995811 6:38258913-38258935 ATCAATAATAATGATCATGATGG + Intronic
1007101506 6:39250693-39250715 ACCAATAATAGTGATGATGATGG + Intergenic
1007696827 6:43739439-43739461 AATAATAATAGTGATGATGACGG - Intergenic
1008259973 6:49353678-49353700 TTGAATAGTAGTGGTGATGGTGG - Intergenic
1008395316 6:50999680-50999702 TATAACAATAATGATGATGATGG - Intergenic
1008595908 6:53041616-53041638 TTTCATTATAATGTTGATGAGGG + Intronic
1009809501 6:68642275-68642297 TTGTGTAATACTGATGGTGATGG + Intronic
1010009113 6:71029214-71029236 TTGAATAAAAATGGTGATAGTGG + Intergenic
1010062351 6:71637726-71637748 TTGAATAAGAGTGATGAGAATGG - Intergenic
1010143013 6:72633108-72633130 TTTAATAATAATCATTCTGATGG + Intronic
1010488765 6:76449684-76449706 TTGAATACTAATATTGATAATGG - Intergenic
1010634919 6:78246889-78246911 ATGAATACTGGTGATGATGATGG + Intergenic
1010738804 6:79474218-79474240 TTGTATAATAATGGTGATAGAGG - Intergenic
1011197801 6:84800229-84800251 ATTAATATTCATGATGATGATGG - Intergenic
1011430967 6:87286277-87286299 TTCAATAAGAATGAAGTTGAAGG - Intronic
1011992694 6:93543180-93543202 TATAATAATAATCATAATGATGG - Intergenic
1012058913 6:94452435-94452457 TTGAATAAAAGTGATGAGGGTGG - Intergenic
1012317835 6:97801743-97801765 TTGGAGAATAATTATGAAGAGGG - Intergenic
1013350420 6:109300860-109300882 TTAATTAATCATGATGCTGATGG + Intergenic
1013577846 6:111502644-111502666 TTGAAAAATAGTAATAATGATGG + Intergenic
1013858667 6:114606645-114606667 TTTAATGATAATAATGATGATGG - Intergenic
1013875402 6:114820463-114820485 TTGAATAGTAACAATGAAGATGG + Intergenic
1013959354 6:115880471-115880493 TGGTATAAAAATGTTGATGAGGG - Intergenic
1014074525 6:117221092-117221114 TTGAATCATAATCAAGAGGAAGG + Intergenic
1014381309 6:120745772-120745794 ATGAATTATAATTATCATGAAGG - Intergenic
1014528303 6:122527702-122527724 TATAATAATAATGATGATAAAGG + Intronic
1014994142 6:128120615-128120637 TTGAATATTAATCATGATAAAGG + Intronic
1015039131 6:128695373-128695395 GTTACTAATAATGATGCTGAAGG + Intergenic
1015393100 6:132705623-132705645 TTGAATAATAGTGGTGAAAATGG - Intronic
1015866746 6:137734735-137734757 TTGTTTAATAATGAGGAAGATGG - Intergenic
1016435993 6:144037630-144037652 TTAAAGAAAAATGATCATGATGG + Intronic
1017218211 6:151935205-151935227 AATAATAATGATGATGATGATGG - Intronic
1018124498 6:160668855-160668877 TAGAATGATGATGATGGTGATGG + Intergenic
1018124521 6:160669010-160669032 CTGAGTAGTAATGATGGTGATGG + Intergenic
1018264655 6:162009464-162009486 TTGAAGAATAGTGATTCTGACGG - Intronic
1018325941 6:162668886-162668908 GTGGATGATAATGATGATGGTGG + Intronic
1018371714 6:163174765-163174787 AACAATAATGATGATGATGATGG - Intronic
1018599035 6:165519011-165519033 TTGAATAAAAAGAAAGATGAGGG + Intronic
1019125287 6:169835611-169835633 TTGAGAATTGATGATGATGAGGG - Intergenic
1020412911 7:7912949-7912971 TTGAAGAATAATCATTATAAGGG - Intronic
1020538544 7:9431159-9431181 TTGAAGAAGGATGATGATGAAGG - Intergenic
1020809093 7:12829655-12829677 TTGAAGAGTAATGCTGGTGATGG - Intergenic
1020943693 7:14572996-14573018 TTGAATAAAAATGGGCATGAGGG + Intronic
1021068124 7:16201912-16201934 TTGAATAGAAATGGTGATTATGG + Intronic
1021290808 7:18842381-18842403 TTGACTAATAAAGAAGATGTGGG + Intronic
1021475163 7:21052608-21052630 TTCTATAATAATGATGATGATGG + Intergenic
1021792627 7:24220896-24220918 TTAAATAGAAATGATGATAATGG - Intergenic
1021860309 7:24899476-24899498 TTTAATAATGATTATAATGATGG - Intronic
1022202663 7:28132631-28132653 CTGAATAATGCTAATGATGAAGG - Intronic
1022381389 7:29863271-29863293 TGGAATAATAATGATAATAAAGG - Intronic
1022600328 7:31752026-31752048 TTGAAGATTAATGATAATGTAGG - Exonic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022686081 7:32597865-32597887 TTGAGCCATAATGATGTTGATGG + Intergenic
1023145471 7:37146564-37146586 TTGAATAATGAGGCTGTTGAAGG + Intronic
1023225573 7:37965505-37965527 GCCAATAATAATGATGATCATGG + Intronic
1023462650 7:40416371-40416393 TTGAATAATAGTGGTAATAAAGG + Intronic
1024286909 7:47765745-47765767 TTTAATCATGATGATGATAATGG + Intronic
1024305406 7:47924856-47924878 TTAAATGAGATTGATGATGATGG - Intronic
1024800159 7:53067880-53067902 TTGAAAAAAAAGGATGAGGATGG + Intergenic
1026256636 7:68717750-68717772 GAGAATAATAAAGATGAAGAAGG - Intergenic
1027423103 7:78036400-78036422 GTAAATAATAATAATAATGATGG + Intronic
1027446428 7:78278987-78279009 TTGAAGAAAAATGAAGATGATGG + Intronic
1027524506 7:79250247-79250269 TTGAATAAAAGTGATGAACATGG - Intronic
1027587145 7:80072507-80072529 TTGAATAAAAGTGATGAAGGTGG - Intergenic
1027609634 7:80344208-80344230 TATAATAATAATGATGATGATGG - Intergenic
1027629324 7:80582992-80583014 TTGAATAATGAAGTTTATGATGG + Intronic
1027868954 7:83681910-83681932 CTTAATAATAATAATTATGATGG + Intergenic
1028005039 7:85554621-85554643 GTGAATACTTATGATGATAATGG + Intergenic
1028102728 7:86841293-86841315 ATGAACAATAAAGATGAAGAAGG + Intronic
1028163933 7:87516554-87516576 TTCAATGATCATGATGATGTGGG + Exonic
1028206791 7:88026760-88026782 TTGAATAATAGTGATGAAATTGG + Intronic
1028337622 7:89676973-89676995 TTGAATAAGAATGTTGAAAAAGG - Intergenic
1028702933 7:93803770-93803792 TTGAATAACAGTGATGATAGTGG - Intronic
1028713460 7:93937283-93937305 AATAATAATCATGATGATGATGG - Intergenic
1028771909 7:94635315-94635337 TTGGATAAGAATGATTAAGAAGG + Intronic
1028799029 7:94940095-94940117 TTGAACCATAATAATCATGATGG + Intronic
1029898506 7:104013041-104013063 TTGAATGAGAATGTTGATGTTGG - Intergenic
1030310493 7:108064145-108064167 ATGAATAATAATGAAAATGAAGG - Intronic
1030462676 7:109860114-109860136 TTTAAAAAAAATGATGATGATGG - Intergenic
1031792280 7:126121148-126121170 TTGAATAATAATGAACACAATGG + Intergenic
1032133806 7:129255680-129255702 GTGAATAAAAATGAAAATGAGGG + Intronic
1032135326 7:129271536-129271558 CTGAATAACAATAATGTTGAAGG + Intronic
1032539456 7:132691240-132691262 TTGACTAATATTGAAGATAAAGG + Intronic
1032885377 7:136132725-136132747 TAGAATAATCATGATGATGAAGG - Intergenic
1032910901 7:136428612-136428634 TTGATTAAAAATGATTATGTGGG - Intergenic
1032970310 7:137154732-137154754 TAAAATAATAATGATAATAAAGG - Intergenic
1033304147 7:140212153-140212175 TTGGATGATGGTGATGATGATGG + Intergenic
1033792237 7:144804805-144804827 TTGAATAAAAATAGTAATGATGG + Intronic
1033824303 7:145170783-145170805 TTGAATTATGAAGATGATGAAGG + Intergenic
1033868818 7:145724369-145724391 TTTACTAATAATGATAATTATGG - Intergenic
1034302369 7:150028121-150028143 TTTAAAAATAATGATTATGCAGG + Intergenic
1034675899 7:152892367-152892389 TTAAATAATAATAATGATACCGG + Intergenic
1034803692 7:154069197-154069219 TTTAAAAATAATGATTATGCAGG - Intronic
1035216276 7:157369885-157369907 TTTAATAATAATGTTGAGAAGGG - Intronic
1035753571 8:2012868-2012890 TTGAATAATAATGGTGAAAGTGG + Intergenic
1036068894 8:5418258-5418280 TAAAACAATAATGATGATGATGG - Intergenic
1036161976 8:6398005-6398027 TTTAATAAAAATGATGATTGGGG + Intergenic
1036164256 8:6417496-6417518 CTGAACAATAATGAAGAAGAAGG - Intronic
1036168437 8:6459519-6459541 TTGAATATTAATGTTGAAAAAGG + Intronic
1037226863 8:16602747-16602769 GAAAATAATAGTGATGATGAAGG - Intergenic
1038007390 8:23444348-23444370 TTCAATGATGATGATGATGATGG + Intronic
1038470284 8:27810957-27810979 TCAAATGATGATGATGATGAAGG - Exonic
1038715899 8:29990819-29990841 GTGAATGAGACTGATGATGATGG + Intergenic
1038921569 8:32090879-32090901 TTTGGTCATAATGATGATGATGG - Intronic
1038979413 8:32740955-32740977 ATTAATAATAATTATGATGATGG + Intronic
1039656043 8:39408769-39408791 TTGAATAGAAATGATGAGAATGG + Intergenic
1040004180 8:42604633-42604655 TTGAACAATAATGAGGTTGAAGG - Intergenic
1040547913 8:48415286-48415308 TTGAATAACAATGGTGAAAATGG - Intergenic
1040734953 8:50493874-50493896 TTGAAAAATAATGGAGATAATGG - Intronic
1041105062 8:54434282-54434304 TTAAAAATTAATGGTGATGATGG + Intergenic
1041142582 8:54839039-54839061 ATATTTAATAATGATGATGATGG - Intergenic
1041208687 8:55524343-55524365 TCAAATGATAATGGTGATGACGG - Exonic
1041898448 8:62954117-62954139 AATAATAATAATGATGATGTTGG - Intronic
1041974470 8:63781499-63781521 GTAAATAATAATGATCTTGAGGG - Intergenic
1042660665 8:71150708-71150730 GATGATAATAATGATGATGATGG - Intergenic
1043021205 8:75002496-75002518 AAAAATAATAATAATGATGAAGG + Intronic
1043125436 8:76388712-76388734 AGGTGTAATAATGATGATGAAGG - Intergenic
1043344387 8:79282895-79282917 AACAAAAATAATGATGATGAGGG - Intergenic
1043497535 8:80818971-80818993 TTTAAAAAAAATGATGATGAGGG - Intronic
1043866135 8:85377926-85377948 TTGAATAGTAATTAAGATGTAGG + Intronic
1043918599 8:85953896-85953918 TTTATTAATATTAATGATGATGG - Intergenic
1044556229 8:93565038-93565060 TTAAATAGTGATGATGATGATGG + Intergenic
1044630430 8:94273029-94273051 TAGGGTAATAATTATGATGATGG - Intergenic
1044791662 8:95853646-95853668 TTAAGTAAAAATGATGTTGATGG + Intergenic
1044818317 8:96135864-96135886 AAAAATAATAATAATGATGATGG + Intergenic
1045143941 8:99317702-99317724 TTGAATAATAATAATAAAAAAGG + Intronic
1045632324 8:104139799-104139821 TTGAATAATAGTGGTGAAAATGG + Intronic
1045828652 8:106431258-106431280 TTTAATGATGATAATGATGATGG + Intronic
1045877897 8:107003836-107003858 TTGAATAGAAATGGTGATAAAGG - Intergenic
1046328170 8:112677281-112677303 ATAAATGATAATGATGATGGTGG + Intronic
1046651130 8:116837667-116837689 TCGACTAATTATGATGGTGAAGG + Intronic
1046686511 8:117233598-117233620 TTGAATATTAAGGGTGATTAAGG - Intergenic
1046695490 8:117334842-117334864 TAGAACAAAAATGCTGATGAAGG - Intergenic
1046760363 8:118014073-118014095 TTAAATAAAGATAATGATGATGG + Intronic
1046776541 8:118169730-118169752 TTGAAAAATAAAAAAGATGAAGG + Intergenic
1047089167 8:121554872-121554894 TTGAATAATAAGGAGGAGAAGGG + Intergenic
1047334360 8:123921792-123921814 TTGGATCTTACTGATGATGATGG + Intronic
1047525421 8:125629211-125629233 TTGAATAAAAATGGTGAAAATGG - Intergenic
1047580858 8:126213839-126213861 TTGAATAAAAATGTGGAGGAGGG + Intergenic
1047815819 8:128461133-128461155 AGAAATAATAATAATGATGATGG + Intergenic
1048185556 8:132237242-132237264 AAGAGTAATGATGATGATGATGG + Intronic
1048413574 8:134201101-134201123 GAGAATAAAAATCATGATGATGG + Intergenic
1048558914 8:135511391-135511413 AAGAATAATAATGAGGAGGATGG - Intronic
1048850209 8:138637845-138637867 TGGAATAATAATGATGGTGATGG - Intronic
1049282297 8:141756157-141756179 GATAATAGTAATGATGATGATGG + Intergenic
1049801418 8:144519274-144519296 GTCAATACTAATGCTGATGAAGG + Intronic
1050115945 9:2263643-2263665 TTAAACAATAATGATGATAGTGG - Intergenic
1050162545 9:2733413-2733435 TAGCAAAATAGTGATGATGATGG - Intronic
1050411046 9:5365235-5365257 TAAAATAATAATAATGATGATGG + Intronic
1050880351 9:10691809-10691831 ATCAATAATAATGATTATCATGG - Intergenic
1051704690 9:19864791-19864813 TTGAATAACAATGATGAAAGTGG - Intergenic
1051840340 9:21389987-21390009 TTTCATAATATTGATGAGGAAGG + Intergenic
1051841829 9:21406482-21406504 TTCAATAAAAATGAAAATGAGGG + Intergenic
1051997911 9:23241349-23241371 TTGCAAAAAAATGAAGATGAGGG + Intergenic
1052629980 9:31025349-31025371 TTGAAGAAGAATGAGGTTGAGGG + Intergenic
1053170499 9:35877085-35877107 TTGAATAATAACAAAGCTGAAGG - Intergenic
1053688854 9:40569829-40569851 TTGAATAAAAGTGATGAGGCTGG - Intergenic
1054275183 9:63061245-63061267 TTGAATAAAAGTGATGAGGCTGG + Intergenic
1054300094 9:63370746-63370768 TTGAATAAAAGTGATGAGGCTGG - Intergenic
1054399648 9:64703695-64703717 TTGAATAAAAGTGATGAGGCTGG - Intergenic
1054433231 9:65187956-65187978 TTGAATAAAAGTGATGAGGCTGG - Intergenic
1054497152 9:65833713-65833735 TTGAATAAAAGTGATGAGGCTGG + Intergenic
1054985399 9:71256404-71256426 TTGAAGAACATTGATGATAAAGG + Intronic
1055314559 9:75020980-75021002 ATGAACAATGATGATGATCATGG + Intronic
1055322219 9:75093863-75093885 TTTCACAATGATGATGATGATGG + Intronic
1055737243 9:79344065-79344087 TCTAATGATAAGGATGATGATGG + Intergenic
1055989128 9:82086411-82086433 TGGAGTGATGATGATGATGATGG - Intergenic
1056695124 9:88842128-88842150 AAAAATAATAATGAGGATGATGG - Intergenic
1057058803 9:91984735-91984757 TTGCATAATGATGATGTTAAGGG - Intergenic
1058293104 9:103268777-103268799 TTAAATAGGAATGATGATAATGG - Intergenic
1058481581 9:105401168-105401190 TTACATAAAAATGATGATTATGG + Intronic
1058768163 9:108203148-108203170 TTGAATAACAGTGATGACAATGG - Intergenic
1058929645 9:109706262-109706284 ACTCATAATAATGATGATGATGG + Intronic
1058961410 9:109995816-109995838 CTGAAAAATAATGATGGTCATGG + Intronic
1059322574 9:113481123-113481145 CTGAGTCTTAATGATGATGAAGG - Intronic
1059436270 9:114278425-114278447 GGTAATGATAATGATGATGATGG + Intronic
1060140668 9:121207147-121207169 CTGAATTAAAGTGATGATGAAGG + Intronic
1060202128 9:121657380-121657402 CTGATTATTAAAGATGATGAGGG - Intronic
1060939939 9:127537472-127537494 CAAAATAATAATGATAATGATGG + Intronic
1203532403 Un_GL000213v1:158691-158713 TTGAATAAGAATGGTGAGAAAGG + Intergenic
1186954218 X:14663153-14663175 TTGCATAATAATGCTAATGTAGG + Intronic
1187204841 X:17171926-17171948 TTGGTTAATAATAATAATGATGG + Intergenic
1187204842 X:17171929-17171951 GTTAATAATAATAATGATGGTGG + Intergenic
1187696310 X:21924583-21924605 TTTAAAAATGATGATGATGAGGG - Intergenic
1188117813 X:26266733-26266755 TTGAATGGCAATGATAATGATGG + Intergenic
1188274463 X:28182684-28182706 TTGTAGAATAATGGTAATGATGG + Intergenic
1188410246 X:29863236-29863258 TTAAACAATAATAATGATGATGG + Intronic
1188724730 X:33568610-33568632 TTGAATAAAAATGATGAAAGTGG + Intergenic
1188796837 X:34477546-34477568 TTGAATAAGAATGATGAGAAAGG + Intergenic
1189226382 X:39416674-39416696 TGCAATAATGATGATGATAATGG + Intergenic
1189406151 X:40725785-40725807 TTGAATAATAGTGGTGAAAATGG - Intronic
1189784231 X:44544614-44544636 TTAAATAATAAGAATGATGCTGG - Intergenic
1190027916 X:46943236-46943258 TTGAATAATAGTGGTGAGAATGG + Intronic
1191033783 X:56004295-56004317 TTGAATGGTAATGATGGTAATGG + Intergenic
1191707398 X:64108459-64108481 TTGAATAGGAATGGTGATAAAGG + Intergenic
1191912786 X:66168829-66168851 ATTAATGATAATGATGATAATGG - Intronic
1192394548 X:70765740-70765762 TTGAATAATAGTGATGACAGTGG - Intronic
1192412237 X:70944259-70944281 TTAAATAATAATGACAATAACGG + Intergenic
1192979312 X:76322271-76322293 TTAAATAACAGTGATGAAGATGG - Intergenic
1193204493 X:78732003-78732025 TTGAATAACAGTGATGATAGTGG + Intergenic
1193278406 X:79619296-79619318 TTTAATAATGATTATAATGAAGG + Intergenic
1193502988 X:82303061-82303083 TTAAATAATAATCATTCTGACGG - Intergenic
1193677014 X:84467130-84467152 ATGACTGTTAATGATGATGATGG + Intronic
1193714117 X:84917240-84917262 TTGAATAGTAATGATGAGAGTGG - Intergenic
1193752727 X:85366162-85366184 TTGAAAAATAATGCTGATGAAGG + Intronic
1194119321 X:89940610-89940632 ATGAAAGATGATGATGATGATGG + Intergenic
1194274588 X:91863595-91863617 TTGAATAATATTGATAAGTAAGG + Intronic
1194278053 X:91912313-91912335 TTGAATAATAATGGTGAAATTGG + Intronic
1194365072 X:93004811-93004833 TTGAATAGTAATGATGAGAGAGG + Intergenic
1194386632 X:93263515-93263537 TTCAATAGTGATGTTGATGAAGG + Intergenic
1194406746 X:93505620-93505642 TTGAAAAATAATAATGCTTATGG - Intergenic
1194547770 X:95259006-95259028 TAGTATAATAATGATCACGAAGG + Intergenic
1194550892 X:95297680-95297702 TTTAATAAAATTGATGAGGAGGG + Intergenic
1194687794 X:96945774-96945796 TGGATTAAACATGATGATGAGGG - Intronic
1194843999 X:98780758-98780780 ATTAATAATGATGATGATGATGG - Intergenic
1194871367 X:99136351-99136373 TTGATTAATAAAGAGAATGATGG - Intergenic
1194885547 X:99311645-99311667 ATTGATAATAATGATGATGGTGG + Intergenic
1195100160 X:101547879-101547901 TTGAATGATAATGGTGATTGAGG - Intergenic
1195298853 X:103507690-103507712 TTGAATAATTATCAGAATGATGG + Intronic
1195390620 X:104358364-104358386 CTGAAAAATTATGAGGATGAGGG + Intergenic
1196514788 X:116596927-116596949 TTAAAAAATGATGATGATGGTGG - Intergenic
1196557696 X:117109185-117109207 TATAATAATAATAATGATAATGG - Intergenic
1196699296 X:118650294-118650316 TTGAATAATAACTATCATGTAGG - Intronic
1197057536 X:122139316-122139338 TCAATAAATAATGATGATGATGG - Intergenic
1197063873 X:122215755-122215777 ATGCCAAATAATGATGATGATGG - Intergenic
1197086675 X:122484916-122484938 TTGAAAAAGAATGAAGTTGAAGG + Intergenic
1197167725 X:123396224-123396246 AATAATAATAATGATGATAAGGG + Intronic
1197302071 X:124793381-124793403 CTGGAGAATAATTATGATGATGG - Intronic
1197368360 X:125595325-125595347 TTGAATAAGAGTGATGAAGGTGG - Intergenic
1197558534 X:127988904-127988926 TTGAATGATGATGATGATGGTGG - Intergenic
1198384039 X:136111084-136111106 TTGAATAAAAGTGATGAGAATGG + Intergenic
1198546410 X:137697111-137697133 TTAAATAATAATGATAATTATGG - Intergenic
1198671856 X:139089839-139089861 ATCAATAATAATAATAATGATGG - Intronic
1198781410 X:140240304-140240326 TTGAATAACAATGGTGACAATGG + Intergenic
1198872135 X:141187538-141187560 TTGAATAACAATGATGAAAGTGG + Intergenic
1199370188 X:147038237-147038259 TTGAATAACACTGGTGATGGTGG + Intergenic
1199400529 X:147393859-147393881 TTGAATAGCAATGATGAGAAAGG - Intergenic
1199776803 X:151019151-151019173 TTGAATAAGGATGATTATCATGG + Intergenic
1200591828 Y:5085002-5085024 TTGAATAATATTGATAAGTAAGG + Intronic
1200595391 Y:5134388-5134410 TTGAATAATAATGGTGAAATTGG + Intronic
1200673300 Y:6121071-6121093 TTGAATAGTAATGATGAGAGAGG + Intergenic
1201215732 Y:11721095-11721117 TTGAATCAAAATGAATATGATGG + Intergenic
1201315501 Y:12641666-12641688 TTGAATAATCCTCATTATGAAGG + Intergenic
1201368690 Y:13236981-13237003 TTAAATAAGAATGATGAAAATGG - Intergenic
1202016785 Y:20416838-20416860 TTGAATAACAGTGGTGATGCTGG + Intergenic