ID: 978611458

View in Genome Browser
Species Human (GRCh38)
Location 4:110545640-110545662
Sequence GTTCAGAGAGGACCAAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978611458_978611460 26 Left 978611458 4:110545640-110545662 CCTACTTTTGGTCCTCTCTGAAC 0: 1
1: 0
2: 1
3: 15
4: 166
Right 978611460 4:110545689-110545711 TTCCTTGTGTTGTGTTTTTATGG No data
978611458_978611461 27 Left 978611458 4:110545640-110545662 CCTACTTTTGGTCCTCTCTGAAC 0: 1
1: 0
2: 1
3: 15
4: 166
Right 978611461 4:110545690-110545712 TCCTTGTGTTGTGTTTTTATGGG 0: 1
1: 0
2: 2
3: 44
4: 1226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978611458 Original CRISPR GTTCAGAGAGGACCAAAAGT AGG (reversed) Intronic
900796030 1:4708880-4708902 GTTCAGAGAGGAAAAAAAAGAGG - Intronic
901987257 1:13085814-13085836 GTTCAGGGAGGAACCAATGTGGG + Intergenic
901994555 1:13140953-13140975 GTTCAGGGAGGAACCAATGTGGG - Intergenic
902732418 1:18378013-18378035 GTGCAGTGAGGACCAAGAGTGGG - Intronic
902926549 1:19699693-19699715 ATTCAGTGAGCACCAAACGTAGG - Intronic
904257261 1:29262190-29262212 GATCAGTGACTACCAAAAGTTGG - Intronic
904365694 1:30009808-30009830 GCTCAGAGAAGACCCACAGTGGG + Intergenic
909054590 1:70806676-70806698 GTGCAGAGGAGACCTAAAGTGGG + Intergenic
909734206 1:78935727-78935749 TTTCAGACAGTAACAAAAGTTGG + Intronic
909800968 1:79806650-79806672 GTGGAGAGGGGACCTAAAGTGGG + Intergenic
911472861 1:98339891-98339913 CTTCAGACATGACCAAAAGCTGG + Intergenic
915429352 1:155853790-155853812 TTTCAGAATGGAACAAAAGTGGG - Exonic
915903877 1:159864178-159864200 GTCCAGAGAGGTCCAAAAAATGG + Intronic
916060745 1:161097099-161097121 GTTCTCTGAGGACCAAGAGTTGG + Intergenic
917688667 1:177444899-177444921 GTTCAGAGAGAACCAGGAGCGGG + Intergenic
918354725 1:183696756-183696778 GTTCAGGGATGACTAAAATTTGG - Intronic
922597282 1:226823755-226823777 TGACAGAGGGGACCAAAAGTAGG - Intergenic
924612716 1:245587243-245587265 GTTCAGTGAGGACCCAAATGAGG - Intronic
1068287692 10:54961704-54961726 GTACAGAGGAGACCCAAAGTGGG - Intronic
1068623900 10:59218409-59218431 GATCATAGAGCTCCAAAAGTGGG + Intronic
1068768651 10:60795705-60795727 GTTGACATAGGATCAAAAGTAGG - Intergenic
1071060845 10:81570041-81570063 GCTCAGAGGGGACCCACAGTGGG + Intergenic
1071185195 10:83035676-83035698 CTTAAAAGAAGACCAAAAGTAGG + Intergenic
1077738791 11:4821562-4821584 GTTCACAGAGGACCACAAACAGG - Exonic
1077844661 11:6012243-6012265 GCTCAGAGAAGACCTGAAGTGGG + Intergenic
1080161428 11:29181408-29181430 TTTCAGAGAGGAGCAAATGCAGG - Intergenic
1080559462 11:33449661-33449683 GGTCAGAGAGGACCATCAGGAGG - Intergenic
1080597229 11:33784162-33784184 GCTGAGAGTAGACCAAAAGTGGG - Intergenic
1082875339 11:57982189-57982211 GTCCAGAGAGGAGCAGGAGTGGG + Intergenic
1083336118 11:61922841-61922863 GATCAGAGAGGAGCAAAAACAGG - Intergenic
1083858239 11:65404526-65404548 CTGCAGAGAGGACGAAGAGTGGG - Intronic
1087064863 11:94018783-94018805 GCTTACAGAGGGCCAAAAGTGGG - Intergenic
1088960524 11:114659285-114659307 ACTCAGAGATGACCAAATGTTGG + Intergenic
1091158900 11:133401100-133401122 ATACCAAGAGGACCAAAAGTTGG + Intronic
1092844684 12:12573066-12573088 GTTCAGAGAAGGAGAAAAGTCGG + Intergenic
1094750425 12:33399960-33399982 GTTCATAGAGGAGCAGATGTGGG + Intronic
1095974997 12:47934183-47934205 GTTAAGAAAAGAACAAAAGTTGG + Intronic
1097078126 12:56410263-56410285 GTTCAGAGGAGACCCACAGTGGG + Intergenic
1101763938 12:107681872-107681894 GCTCAGAGAAGACCCACAGTGGG + Intergenic
1104265458 12:127228393-127228415 GTTCATAAAGAACCAAAATTTGG - Intergenic
1106568175 13:30905095-30905117 GTTCAGAGAGGCCCAGAGATGGG + Intergenic
1106699750 13:32216618-32216640 ATTCAGAAAGGAACAAAAGCAGG - Intronic
1106780767 13:33056999-33057021 GTTCAGAGAGGATCTGAGGTGGG + Intronic
1107600345 13:42006353-42006375 CTTCAGAGAGGACTGGAAGTGGG - Intergenic
1107737321 13:43413430-43413452 ATTCAGAGAGGGAAAAAAGTTGG + Intronic
1107972750 13:45659900-45659922 GTTCACAGAGGACAAAAAAAGGG - Intergenic
1109633658 13:65085566-65085588 GCTCAGAGAGGACCTGGAGTGGG + Intergenic
1110698736 13:78522425-78522447 GTGGAGAGAGGACCAAAAGATGG + Intergenic
1112052771 13:95660159-95660181 GTACAGAGAGAAAGAAAAGTGGG - Intergenic
1113113371 13:106848423-106848445 GTACAGAGAGAATGAAAAGTAGG - Intergenic
1114887770 14:26875876-26875898 CTTCAGAGAAGATCAAAATTAGG - Intergenic
1115879371 14:37897835-37897857 TCTCAGAGAGGACCAAAACAGGG + Intronic
1119147203 14:72328136-72328158 GTTCAGATAGAACAAAAAGAAGG - Intronic
1120624843 14:86812318-86812340 TTTCAAAGAGTAGCAAAAGTGGG - Intergenic
1121057984 14:90876672-90876694 GACCAGAGAGGACCAAAAGGCGG + Intronic
1122239149 14:100350509-100350531 GTTCAGAGAGCGCTGAAAGTGGG + Intronic
1125582306 15:40795038-40795060 TTCCAGAGAGGAGCAAGAGTCGG - Intronic
1128263246 15:66247539-66247561 CCTCAGAGAGGATCAAAATTAGG - Intronic
1130049622 15:80472992-80473014 GCTGAGAGAGGAACAAAGGTAGG - Intronic
1130994960 15:88898596-88898618 GCTCAGGGAGGACCACAGGTGGG + Intergenic
1135339583 16:21634506-21634528 GTTCAGAGAGGACAGAAAATGGG - Intronic
1135992294 16:27225404-27225426 GTTCAGAGAGGAACAAACTGAGG + Intronic
1137455593 16:48615492-48615514 GTGCAGAGAGGAGCAGAGGTGGG - Intronic
1137801243 16:51263956-51263978 ATTCAGAGATGAACAACAGTGGG - Intergenic
1143572842 17:7771310-7771332 ATTCTGAGGGGGCCAAAAGTTGG - Exonic
1147863616 17:43538667-43538689 TTTGAGAGAGGGGCAAAAGTGGG - Intronic
1148547243 17:48527715-48527737 GTTTGGAGAGGACAAAAAGAGGG - Intergenic
1149254033 17:54804410-54804432 CTTTAGACAGCACCAAAAGTAGG + Intergenic
1150844686 17:68643267-68643289 GTTCAGAGGGCACATAAAGTTGG + Intergenic
1151822264 17:76502620-76502642 GTGCAGAGAGGAACAAAACCAGG + Intergenic
1152112754 17:78366138-78366160 GTGCAGAGAGGATGAAATGTTGG + Intergenic
1154006092 18:10528376-10528398 GTTAACAGAGGACTAAAAATAGG + Intronic
1157042847 18:44060837-44060859 GCTCAGAGAAGACCCACAGTAGG + Intergenic
1157896929 18:51478355-51478377 GATCAGAGAGGAGCAGCAGTTGG + Intergenic
1159120307 18:64161357-64161379 TTTCAGAGAGAATAAAAAGTTGG + Intergenic
1159568691 18:70086745-70086767 TTTCAGAGATGACCACAAGATGG - Intronic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1162558273 19:11401098-11401120 GGTCAGATAGGACCAAAGATGGG + Intronic
1162739510 19:12766047-12766069 GGACAGAGGGGGCCAAAAGTGGG - Intronic
1164526941 19:29019648-29019670 GTTGCGAGAGGACCCACAGTAGG - Intergenic
1164997162 19:32730115-32730137 GTCCAGAGAAGACCAATGGTGGG - Intronic
1165022700 19:32936931-32936953 GTTCAGAGGAGACCCACAGTGGG - Intronic
1167711413 19:51113641-51113663 GTTCAGAGACGTCCAAATGTGGG - Intergenic
1168240813 19:55088023-55088045 GTTCAGAGAGAAACCAAAGAGGG - Intergenic
926679850 2:15654777-15654799 GTGCAGAGAGCACAAAAACTGGG - Intergenic
927461469 2:23302121-23302143 GTGCAGAAAGAACCCAAAGTGGG - Intergenic
929780295 2:44952848-44952870 GCTCAGAGAGGGCCATAATTTGG + Intergenic
930024041 2:47019548-47019570 GGTCAGAGTGGATCACAAGTTGG + Intronic
931300546 2:60974165-60974187 GTTCAGAGAAGACCCACAGTGGG - Intronic
932501596 2:72187478-72187500 GCTCAGAGATGACCCACAGTGGG + Intronic
933046383 2:77542182-77542204 CCTCAGAGAGGACCAAGAATTGG - Intronic
934602767 2:95670758-95670780 GTTCAGAGAGGTCCAAGAGCTGG + Intergenic
936536149 2:113312951-113312973 GTTCGGAGAGGTCCAAGAGCTGG + Intergenic
937160100 2:119752404-119752426 GTTCTGAGAAGATCAAAATTTGG + Intergenic
938978863 2:136506837-136506859 GTTAAGAGAAGGCCAAAAGAAGG - Intergenic
945994641 2:216425706-216425728 GTGGAGAGGGGACCCAAAGTGGG + Intronic
948095914 2:235334088-235334110 GTTCAGAAAGGACCAGAGGGAGG - Intergenic
1169519133 20:6352191-6352213 GTTAAGTGAGGTCCCAAAGTAGG + Intergenic
1170007584 20:11686148-11686170 CTTCAAAGAGCACGAAAAGTGGG - Intergenic
1175746692 20:61461968-61461990 GATCTGGGAGGACTAAAAGTGGG - Intronic
1178426288 21:32481113-32481135 GTACAGAGAGGCCCAAAACTGGG - Intronic
1179329386 21:40384149-40384171 GTTCAGGGAGGCCCACAGGTTGG + Intronic
950886227 3:16365366-16365388 GTTAAGAAAGTACAAAAAGTAGG + Intronic
953993705 3:47503364-47503386 GTTCAGAAAGGAGGAAAAGCAGG + Intronic
956455052 3:69412446-69412468 GAGCAGAGGGGACCGAAAGTAGG + Intronic
957012622 3:75025778-75025800 GCACAAAGAGGACCATAAGTGGG - Intergenic
959145817 3:102543131-102543153 GTTCAGAGAACTCAAAAAGTGGG - Intergenic
959427325 3:106207148-106207170 GAACAGAGAGGAACAAAGGTGGG - Intergenic
963059994 3:141217695-141217717 GTGCAGAGAGCTCAAAAAGTGGG - Intergenic
963346314 3:144099601-144099623 GTTCTCAGAGGACCCAAAGTGGG - Intergenic
964882223 3:161435758-161435780 GTTCAGAGAGGAATATAAGCTGG - Intergenic
965682523 3:171266078-171266100 GTTGAGAGAGGAAAAAAAGGAGG + Intronic
970709314 4:18843210-18843232 GTAGAGAGGGGACCCAAAGTGGG + Intergenic
972451688 4:39206545-39206567 ATTAATAGAGGACCAAAATTAGG + Intronic
975044452 4:69783998-69784020 GCTCAGAGAAGACCCACAGTGGG - Intronic
977033958 4:91925239-91925261 GCTCAGAGCGGACCCACAGTGGG - Intergenic
978229851 4:106385509-106385531 GCTCAGAGAAGACCCACAGTGGG + Intergenic
978611458 4:110545640-110545662 GTTCAGAGAGGACCAAAAGTAGG - Intronic
982258647 4:153473934-153473956 CTTCAGAGAGCACCCAAAGTGGG - Intronic
985007967 4:185553467-185553489 ATTCAGAGAGTACCAAGAGCAGG + Intergenic
985150843 4:186945665-186945687 GTTCAGAGAGGAGCAAAATCAGG + Intergenic
987246066 5:16050052-16050074 GTTCAGAGTGAATAAAAAGTGGG + Intergenic
987634184 5:20518442-20518464 GTTCAGAGAGGAACCAAAAAGGG - Intronic
988675503 5:33428681-33428703 GAGCAGAGAGGAGCAAAGGTGGG - Intergenic
996206741 5:120747363-120747385 GTTCTTAGAGGAGTAAAAGTTGG - Intergenic
997199127 5:131999133-131999155 CTTGGGAGAGGACCCAAAGTGGG + Intronic
999569517 5:152903354-152903376 TTTCAAAGAGGAACAATAGTGGG + Intergenic
1001168882 5:169398002-169398024 GCTAAAAGAGGACCAAATGTAGG - Intergenic
1002314536 5:178334504-178334526 TTTCAAAGAGGACCATAACTCGG + Intronic
1002986279 6:2192290-2192312 GCTCAGAGAAGACCCACAGTGGG - Intronic
1004720321 6:18263582-18263604 GTTTAGAGCGGACGAGAAGTCGG + Intronic
1005804489 6:29461799-29461821 GTTCAGAGAAGCCCAGAAGGAGG - Exonic
1005819719 6:29587974-29587996 GTTCAGAGAAGCCCAGAAGGAGG - Exonic
1006240979 6:32678914-32678936 GTTTAGAGAGGAACATAAATAGG - Intergenic
1012316881 6:97791612-97791634 GTGGAGAGAGGACCCGAAGTGGG + Intergenic
1012328794 6:97958501-97958523 GTGAAGAGGGGACCCAAAGTGGG + Intergenic
1012567951 6:100683867-100683889 GTTCACATAGAAACAAAAGTAGG + Intronic
1014496644 6:122132465-122132487 AATCAGAGTTGACCAAAAGTGGG - Intergenic
1017420446 6:154267633-154267655 GCTCAGAGAAGACCCATAGTGGG + Intronic
1017449179 6:154537732-154537754 GTTAAAAGAAGACCAAAGGTTGG + Intergenic
1018911532 6:168103174-168103196 GATCAGAGTGGACCAAGAGTGGG - Intergenic
1023029631 7:36080961-36080983 TTTCAGAGAGGACCGAAAGTGGG - Intronic
1026227042 7:68451309-68451331 GTTCCTAGAAGACCAAAAGATGG + Intergenic
1027809692 7:82879525-82879547 TTACAGAGAGCACAAAAAGTAGG + Intronic
1029420325 7:100468572-100468594 CTCCAGAGAAGACCAAAAATGGG + Intronic
1031910730 7:127514135-127514157 GCTCTGAGAGTACCAAGAGTAGG - Intergenic
1031925951 7:127638753-127638775 GTACAGAGAGACCCTAAAGTTGG - Intergenic
1032186848 7:129734058-129734080 GGTCAGAGAGCTCCACAAGTGGG - Intronic
1033759196 7:144421952-144421974 GTTCAGAGAGGACAGAAAATGGG - Intergenic
1040853695 8:51927276-51927298 TTGCAGAGAGGACCAAGAGCTGG + Intergenic
1041205457 8:55494558-55494580 GCTCAGAGGAGACCCAAAGTGGG + Intronic
1041241852 8:55855051-55855073 GTTCAAAGATGACCATAGGTTGG - Intergenic
1042120820 8:65486257-65486279 GTTCAGAGAAGGCCAAAAACCGG - Intergenic
1043218096 8:77621198-77621220 GATGAGAGGGGACCCAAAGTAGG + Intergenic
1044639159 8:94360364-94360386 GTTCAGAGAGGCCCATAACCTGG + Intergenic
1044976295 8:97669006-97669028 GTTCAGAGAGGGTAAGAAGTGGG - Intronic
1049015640 8:139918209-139918231 GTTCAGAGAAGGCCAAGGGTTGG + Intronic
1053617437 9:39782095-39782117 GCTCAGAGAAGACCCACAGTGGG - Intergenic
1053875619 9:42541458-42541480 GCTCAGAGAAGACCCACAGTGGG - Intergenic
1054236080 9:62560266-62560288 GCTCAGAGAAGACCCACAGTGGG + Intergenic
1054266729 9:62925342-62925364 GCTCAGAGAAGACCCACAGTGGG + Intergenic
1054550222 9:66594796-66594818 GCTCAGAGAAGACCCACAGTGGG + Intergenic
1055028992 9:71753090-71753112 GTTCAGAGAGGATCATAACGGGG - Intronic
1055956631 9:81780023-81780045 GTTAAGATAGGGCCAAGAGTGGG + Intergenic
1056949000 9:91026894-91026916 GCTCAGAGAGGAGCCAAAGAAGG - Intergenic
1057309525 9:93933404-93933426 GTGCTGAAAGGACCAAAAGATGG - Intergenic
1057583615 9:96309643-96309665 GTTCTGTGAGATCCAAAAGTAGG - Intergenic
1058510850 9:105714264-105714286 GCTCAGAGAAGACCCACAGTGGG - Intronic
1060208306 9:121695489-121695511 GTTCAGAGAGGTCCAGTAATCGG + Intronic
1060299501 9:122366742-122366764 ATGCAGAGAGGAAGAAAAGTGGG - Intergenic
1060674144 9:125497016-125497038 GATCAGAGAGGAGTAAAGGTAGG + Intronic
1061363785 9:130159831-130159853 GTTCAGACAGGACCAGGAGATGG - Intergenic
1187045571 X:15645338-15645360 GTTCAGAGAGGGCCAAGCATTGG - Intronic
1190369550 X:49727601-49727623 GCTCAGAGAAGACCCATAGTGGG - Intergenic
1191016396 X:55813995-55814017 GCTCAGAGGAGACCCAAAGTGGG - Intergenic
1191608697 X:63088517-63088539 GTCCAAAAAGGAGCAAAAGTAGG - Intergenic
1192265286 X:69533488-69533510 GCTCAGAGGGGACCCACAGTGGG + Intergenic
1192602989 X:72484694-72484716 GTTCAGAGTGGACAAGTAGTTGG + Intronic
1193467598 X:81867819-81867841 ACTCAGAGAAGACCCAAAGTGGG + Intergenic
1194498904 X:94655701-94655723 TTTCAGAGGGGAAGAAAAGTTGG + Intergenic
1198708929 X:139480181-139480203 GTTCAGAGTGGAATAAAAGTAGG - Intergenic
1200776257 Y:7172760-7172782 GTTCAGAGAGGACAGAAAAATGG + Intergenic
1201366013 Y:13206962-13206984 GTTCACAGAGGAACAACCGTAGG - Intergenic