ID: 978613302

View in Genome Browser
Species Human (GRCh38)
Location 4:110567984-110568006
Sequence TAATACTCCCAAAATTATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978613302_978613305 28 Left 978613302 4:110567984-110568006 CCTTGATAATTTTGGGAGTATTA No data
Right 978613305 4:110568035-110568057 CAGATTATTTCCTGTGGTAAAGG No data
978613302_978613304 22 Left 978613302 4:110567984-110568006 CCTTGATAATTTTGGGAGTATTA No data
Right 978613304 4:110568029-110568051 TTGGAACAGATTATTTCCTGTGG No data
978613302_978613306 29 Left 978613302 4:110567984-110568006 CCTTGATAATTTTGGGAGTATTA No data
Right 978613306 4:110568036-110568058 AGATTATTTCCTGTGGTAAAGGG No data
978613302_978613303 3 Left 978613302 4:110567984-110568006 CCTTGATAATTTTGGGAGTATTA No data
Right 978613303 4:110568010-110568032 AAATGATTACATGTAGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978613302 Original CRISPR TAATACTCCCAAAATTATCA AGG (reversed) Intergenic
No off target data available for this crispr