ID: 978618707

View in Genome Browser
Species Human (GRCh38)
Location 4:110619529-110619551
Sequence CGCCGTCTGGGGCGACAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 84}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978618707_978618716 4 Left 978618707 4:110619529-110619551 CCTCCCTGTCGCCCCAGACGGCG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 978618716 4:110619556-110619578 TTGTGTATTGGAGAGAGGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 236
978618707_978618714 -8 Left 978618707 4:110619529-110619551 CCTCCCTGTCGCCCCAGACGGCG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 978618714 4:110619544-110619566 AGACGGCGGCTTTTGTGTATTGG 0: 1
1: 0
2: 0
3: 1
4: 41
978618707_978618715 -1 Left 978618707 4:110619529-110619551 CCTCCCTGTCGCCCCAGACGGCG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 978618715 4:110619551-110619573 GGCTTTTGTGTATTGGAGAGAGG 0: 1
1: 0
2: 0
3: 13
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978618707 Original CRISPR CGCCGTCTGGGGCGACAGGG AGG (reversed) Intronic
900215408 1:1478983-1479005 TGCAGTCTGGGCCGACTGGGCGG - Intronic
900222669 1:1517650-1517672 TGCAGTCTGGGCCGACTGGGCGG - Intronic
900287625 1:1909132-1909154 CGCCGTCTGGTGGGAAAGCGCGG + Intergenic
900594508 1:3474611-3474633 CCCCGTGTGGGGCTGCAGGGTGG - Intronic
901664143 1:10816977-10816999 CCCTGCCTGGGGCGACTGGGGGG + Intergenic
902429608 1:16352701-16352723 CACTGTCTGGGGCAACTGGGTGG + Intronic
911023449 1:93411982-93412004 AGCTGTCTGGAGGGACAGGGGGG - Intergenic
924754977 1:246932241-246932263 CGCCGCCGGGGCCGCCAGGGCGG - Intergenic
1065727094 10:28677318-28677340 CGGCGTCTGGGGCGCCCGGCTGG - Intergenic
1077098429 11:809973-809995 CGACCTCGGTGGCGACAGGGAGG - Exonic
1077600810 11:3573198-3573220 GGCCGCCTGGGACGTCAGGGTGG + Intergenic
1083424982 11:62578851-62578873 CGGAGTTTGGGGCGCCAGGGAGG + Exonic
1084256730 11:67947783-67947805 GGCCGCCTGGGACGTCAGGGTGG + Intergenic
1084816036 11:71647487-71647509 GGCCGCCTGGGACGTCAGGGTGG - Intergenic
1097269466 12:57765365-57765387 CGGCGTCTGAGGCGCCAGCGGGG - Exonic
1106157350 13:27171360-27171382 CGCCGCCTGGTGGGCCAGGGCGG - Intronic
1106533536 13:30617767-30617789 CTGCGTCTGCGGCCACAGGGCGG + Exonic
1107830568 13:44371313-44371335 GGAGGTCTGGGGGGACAGGGTGG + Intergenic
1108577257 13:51801216-51801238 CTCCATCCTGGGCGACAGGGTGG - Intronic
1110298542 13:73898610-73898632 CTCTGTCTGGGATGACAGGGTGG + Intronic
1113793564 13:113043448-113043470 CGCCGCCTGGGGCAAGAGGGAGG + Intronic
1113879576 13:113616470-113616492 CACCGTCTGCGGCGCCAGGCCGG + Intronic
1114665773 14:24376474-24376496 CCCCGTCTGGGGGTACAGAGGGG - Exonic
1117723164 14:58646561-58646583 CGCGGGCGGGGGCCACAGGGCGG + Exonic
1118029333 14:61804969-61804991 CACCGTGTGAGGTGACAGGGAGG + Intergenic
1122809593 14:104281446-104281468 CTCAGTCTGGGGCCAGAGGGTGG - Intergenic
1122919129 14:104872808-104872830 CGCCCTCTGGGGCAACAGCCTGG - Intronic
1123943278 15:25226901-25226923 CACCATCTGGGGAGACAGGAGGG - Intergenic
1124230190 15:27938336-27938358 TGCCGCCTGGTGAGACAGGGTGG - Intronic
1132872634 16:2122549-2122571 CGCCGTGGGGTGGGACAGGGTGG + Intronic
1132909281 16:2299978-2300000 CGCCTCCTGTGGGGACAGGGAGG - Intronic
1133219829 16:4315423-4315445 CGCCGCCCGGGGCCGCAGGGGGG + Exonic
1134551731 16:15141749-15141771 CGCCGTGGGGTGGGACAGGGTGG + Intergenic
1141911976 16:87066542-87066564 CACCGTCCGGGGTGCCAGGGAGG - Intergenic
1142107780 16:88315597-88315619 CTCCTTCTGGGGTCACAGGGAGG - Intergenic
1152809566 17:82375181-82375203 CGCCGTCCGCGGCGCCAGCGGGG - Exonic
1153522284 18:5964223-5964245 AGCAGTCTGGGGAGACTGGGAGG + Intronic
1154132766 18:11750979-11751001 CGCCGCCTGGGGAGCCGGGGCGG + Intronic
1156008456 18:32470512-32470534 CGCGGTCTGGGGCGCGCGGGAGG + Intergenic
1157334971 18:46731480-46731502 CTCCTGCTGGGGCGAGAGGGAGG - Intronic
1160502736 18:79410436-79410458 CGCCGTGGGGAGCGGCAGGGCGG - Exonic
1162799441 19:13102800-13102822 CGCCGCCAGGGGTGAGAGGGAGG - Exonic
1162946822 19:14049054-14049076 CTCCGTCTGGGGGTTCAGGGAGG + Exonic
1163184013 19:15623774-15623796 CCCAGTCTGGGGCTACAGTGGGG + Intronic
1163724561 19:18915277-18915299 CGCCATCGGGGGCACCAGGGTGG + Intronic
1164244154 19:23415977-23415999 CACCGGCTGGGGCGAGAGGGGGG + Intergenic
1168352664 19:55685653-55685675 GGCCGTCAGGGGCCGCAGGGAGG - Intronic
927213159 2:20650974-20650996 CGCAGTCCGGGGCGCCCGGGCGG - Intronic
932773939 2:74515963-74515985 CGCCGTCTGGCGCCTAAGGGAGG - Exonic
937304509 2:120862915-120862937 CTCCGACTGGGGAGCCAGGGAGG - Intronic
947967798 2:234296677-234296699 TGCCCTTTGGGGCGACAGAGTGG - Intergenic
1172988207 20:39010417-39010439 TGCTGTCTGGGGCCATAGGGAGG + Intronic
1175429122 20:58890303-58890325 CGCCGTCGGGGGCGCCGAGGAGG + Intronic
1179982719 21:44905028-44905050 CGGCGTCTGCAGCGACATGGAGG + Intronic
1180259761 21:46661412-46661434 CGCCAGCTGGGGCGCCAGGCAGG - Intronic
1181964706 22:26648194-26648216 CACCTGCTGGGGCGACTGGGAGG + Intergenic
1182494233 22:30694992-30695014 CGCCGTGTGGCACGACAGGCAGG - Exonic
1183135287 22:35881255-35881277 CTCCGTCTCGGGTGGCAGGGAGG + Intronic
1184604343 22:45563523-45563545 CACTGTCTGTGCCGACAGGGAGG + Intronic
949498393 3:4655238-4655260 TGCCGTCTGTGGTGACATGGAGG + Intronic
950978947 3:17280876-17280898 CTCCTTCTGGGGCTTCAGGGTGG + Intronic
953251180 3:41246883-41246905 CGAGGGCTGGGGCCACAGGGCGG + Exonic
961282469 3:125774832-125774854 GGCCGCCTGGGACGTCAGGGTGG - Intergenic
961458293 3:127034896-127034918 CGCCCTCAGGGGCTCCAGGGTGG - Exonic
966296317 3:178427694-178427716 CACTGTCTGGGGCCAGAGGGTGG - Intronic
968450592 4:674352-674374 CGCCGTCAGCGGCGAGAGAGCGG + Intronic
968453687 4:686846-686868 CGCCCTCGGGGGAGGCAGGGTGG - Intronic
969738699 4:9008790-9008812 GGCCGCCTGGGACGTCAGGGTGG - Intergenic
978618707 4:110619529-110619551 CGCCGTCTGGGGCGACAGGGAGG - Intronic
982370387 4:154627121-154627143 CGCCTTCTGGGGAGACGCGGAGG + Intronic
982384202 4:154781906-154781928 CGCCGTCTGGGGCGTCCCGACGG + Intronic
986825354 5:11514832-11514854 CTCCATCTTGGGCGACAGAGCGG - Intronic
992431412 5:76715110-76715132 CGGAGGCTGGGGCGAAAGGGTGG + Intergenic
1012191607 6:96287044-96287066 GGCTGTCTGGGCAGACAGGGAGG + Intergenic
1018433957 6:163744592-163744614 CACCGTGTGGGGCCCCAGGGAGG + Intergenic
1019526964 7:1484860-1484882 CGGCTTCTTGGGCCACAGGGAGG - Intronic
1019594031 7:1850205-1850227 CCCCTTCTGGGGCAACAGGACGG + Intronic
1024929469 7:54654926-54654948 CTCCATCCTGGGCGACAGGGTGG + Intergenic
1026977105 7:74505573-74505595 CGCTGTCTGGGGCAGCCGGGGGG + Intronic
1029459512 7:100686965-100686987 CGGCGGCCGGGGCGGCAGGGAGG - Intronic
1031071980 7:117171980-117172002 CTCCATCTGGGGTGACAGAGAGG - Intronic
1032194483 7:129781172-129781194 TGCCGTCTGGGGCGGCCGGGCGG - Intergenic
1036243774 8:7100070-7100092 GGCCGCCTGGGACGTCAGGGTGG - Intergenic
1036681164 8:10875397-10875419 CGGCTTCTGGGAGGACAGGGTGG - Intergenic
1049410607 8:142472234-142472256 TCCAGTCTGGGGCGCCAGGGTGG + Intronic
1049577557 8:143396776-143396798 CGCCTGCTGGGGCTCCAGGGAGG + Intergenic
1061402423 9:130375741-130375763 CGCCCTCTGGGGGGAAAGGAGGG + Intronic
1193904272 X:87224031-87224053 CGCCGTCTGAGGCAACAGTGAGG + Intergenic
1196379066 X:115069193-115069215 CGCCGCCTGGGTCGCCAGGGAGG - Intergenic
1200064827 X:153499350-153499372 CGCCGACTGTGGGGACAGGCTGG + Intronic