ID: 978623387

View in Genome Browser
Species Human (GRCh38)
Location 4:110656994-110657016
Sequence AATTATGTTGGTGTTTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978623387_978623393 6 Left 978623387 4:110656994-110657016 CCCTCAAAAACACCAACATAATT No data
Right 978623393 4:110657023-110657045 GTCAGGGAGAACTTCAGCCAGGG No data
978623387_978623391 -10 Left 978623387 4:110656994-110657016 CCCTCAAAAACACCAACATAATT No data
Right 978623391 4:110657007-110657029 CAACATAATTATTATTGTCAGGG No data
978623387_978623396 27 Left 978623387 4:110656994-110657016 CCCTCAAAAACACCAACATAATT No data
Right 978623396 4:110657044-110657066 GGTGGAAAGAATCTTGTTTGAGG No data
978623387_978623392 5 Left 978623387 4:110656994-110657016 CCCTCAAAAACACCAACATAATT No data
Right 978623392 4:110657022-110657044 TGTCAGGGAGAACTTCAGCCAGG No data
978623387_978623397 28 Left 978623387 4:110656994-110657016 CCCTCAAAAACACCAACATAATT No data
Right 978623397 4:110657045-110657067 GTGGAAAGAATCTTGTTTGAGGG No data
978623387_978623394 9 Left 978623387 4:110656994-110657016 CCCTCAAAAACACCAACATAATT No data
Right 978623394 4:110657026-110657048 AGGGAGAACTTCAGCCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978623387 Original CRISPR AATTATGTTGGTGTTTTTGA GGG (reversed) Intergenic
No off target data available for this crispr