ID: 978623388

View in Genome Browser
Species Human (GRCh38)
Location 4:110656995-110657017
Sequence TAATTATGTTGGTGTTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978623388_978623396 26 Left 978623388 4:110656995-110657017 CCTCAAAAACACCAACATAATTA No data
Right 978623396 4:110657044-110657066 GGTGGAAAGAATCTTGTTTGAGG No data
978623388_978623393 5 Left 978623388 4:110656995-110657017 CCTCAAAAACACCAACATAATTA No data
Right 978623393 4:110657023-110657045 GTCAGGGAGAACTTCAGCCAGGG No data
978623388_978623392 4 Left 978623388 4:110656995-110657017 CCTCAAAAACACCAACATAATTA No data
Right 978623392 4:110657022-110657044 TGTCAGGGAGAACTTCAGCCAGG No data
978623388_978623397 27 Left 978623388 4:110656995-110657017 CCTCAAAAACACCAACATAATTA No data
Right 978623397 4:110657045-110657067 GTGGAAAGAATCTTGTTTGAGGG No data
978623388_978623394 8 Left 978623388 4:110656995-110657017 CCTCAAAAACACCAACATAATTA No data
Right 978623394 4:110657026-110657048 AGGGAGAACTTCAGCCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978623388 Original CRISPR TAATTATGTTGGTGTTTTTG AGG (reversed) Intergenic
No off target data available for this crispr