ID: 978623389

View in Genome Browser
Species Human (GRCh38)
Location 4:110657006-110657028
Sequence CCTGACAATAATAATTATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978623389_978623394 -3 Left 978623389 4:110657006-110657028 CCAACATAATTATTATTGTCAGG No data
Right 978623394 4:110657026-110657048 AGGGAGAACTTCAGCCAGGGTGG No data
978623389_978623397 16 Left 978623389 4:110657006-110657028 CCAACATAATTATTATTGTCAGG No data
Right 978623397 4:110657045-110657067 GTGGAAAGAATCTTGTTTGAGGG No data
978623389_978623393 -6 Left 978623389 4:110657006-110657028 CCAACATAATTATTATTGTCAGG No data
Right 978623393 4:110657023-110657045 GTCAGGGAGAACTTCAGCCAGGG No data
978623389_978623392 -7 Left 978623389 4:110657006-110657028 CCAACATAATTATTATTGTCAGG No data
Right 978623392 4:110657022-110657044 TGTCAGGGAGAACTTCAGCCAGG No data
978623389_978623396 15 Left 978623389 4:110657006-110657028 CCAACATAATTATTATTGTCAGG No data
Right 978623396 4:110657044-110657066 GGTGGAAAGAATCTTGTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978623389 Original CRISPR CCTGACAATAATAATTATGT TGG (reversed) Intergenic
No off target data available for this crispr