ID: 978623394

View in Genome Browser
Species Human (GRCh38)
Location 4:110657026-110657048
Sequence AGGGAGAACTTCAGCCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978623387_978623394 9 Left 978623387 4:110656994-110657016 CCCTCAAAAACACCAACATAATT No data
Right 978623394 4:110657026-110657048 AGGGAGAACTTCAGCCAGGGTGG No data
978623389_978623394 -3 Left 978623389 4:110657006-110657028 CCAACATAATTATTATTGTCAGG No data
Right 978623394 4:110657026-110657048 AGGGAGAACTTCAGCCAGGGTGG No data
978623388_978623394 8 Left 978623388 4:110656995-110657017 CCTCAAAAACACCAACATAATTA No data
Right 978623394 4:110657026-110657048 AGGGAGAACTTCAGCCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978623394 Original CRISPR AGGGAGAACTTCAGCCAGGG TGG Intergenic
No off target data available for this crispr