ID: 978625012

View in Genome Browser
Species Human (GRCh38)
Location 4:110675456-110675478
Sequence TAGTATATGTATTTGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978625009_978625012 3 Left 978625009 4:110675430-110675452 CCATGCATGTGTTTGTGTGTATA No data
Right 978625012 4:110675456-110675478 TAGTATATGTATTTGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978625012 Original CRISPR TAGTATATGTATTTGGAGGA AGG Intergenic
No off target data available for this crispr