ID: 978641512

View in Genome Browser
Species Human (GRCh38)
Location 4:110876440-110876462
Sequence CAGCGCGACTCCGTGGGCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978641506_978641512 28 Left 978641506 4:110876389-110876411 CCAGTCTCGCTGCCGCCTTGCAG 0: 9
1: 1095
2: 2135
3: 1700
4: 760
Right 978641512 4:110876440-110876462 CAGCGCGACTCCGTGGGCGTAGG No data
978641505_978641512 29 Left 978641505 4:110876388-110876410 CCCAGTCTCGCTGCCGCCTTGCA 0: 8
1: 1117
2: 2201
3: 1758
4: 763
Right 978641512 4:110876440-110876462 CAGCGCGACTCCGTGGGCGTAGG No data
978641507_978641512 16 Left 978641507 4:110876401-110876423 CCGCCTTGCAGTTTGATCTCAGA 0: 2869
1: 1007
2: 456
3: 293
4: 360
Right 978641512 4:110876440-110876462 CAGCGCGACTCCGTGGGCGTAGG No data
978641508_978641512 13 Left 978641508 4:110876404-110876426 CCTTGCAGTTTGATCTCAGACAG 0: 12
1: 3705
2: 1417
3: 736
4: 671
Right 978641512 4:110876440-110876462 CAGCGCGACTCCGTGGGCGTAGG No data
978641504_978641512 30 Left 978641504 4:110876387-110876409 CCCCAGTCTCGCTGCCGCCTTGC 0: 8
1: 1091
2: 2166
3: 1763
4: 806
Right 978641512 4:110876440-110876462 CAGCGCGACTCCGTGGGCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978641512 Original CRISPR CAGCGCGACTCCGTGGGCGT AGG Intergenic
No off target data available for this crispr