ID: 978649017

View in Genome Browser
Species Human (GRCh38)
Location 4:110977965-110977987
Sequence GACACTGAGGTGACTATAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978649013_978649017 19 Left 978649013 4:110977923-110977945 CCAAAGAGCATTATAGCTATGAT No data
Right 978649017 4:110977965-110977987 GACACTGAGGTGACTATAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978649017 Original CRISPR GACACTGAGGTGACTATAGT TGG Intergenic
No off target data available for this crispr